ID: 1128688369

View in Genome Browser
Species Human (GRCh38)
Location 15:69704348-69704370
Sequence AGAGCTCTGCCAAGGCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128688369_1128688375 6 Left 1128688369 15:69704348-69704370 CCTCTTGGCCTTGGCAGAGCTCT No data
Right 1128688375 15:69704377-69704399 GTTGGGGATGTGTTGGCTGCTGG No data
1128688369_1128688377 20 Left 1128688369 15:69704348-69704370 CCTCTTGGCCTTGGCAGAGCTCT No data
Right 1128688377 15:69704391-69704413 GGCTGCTGGGTGATCTTTGCTGG No data
1128688369_1128688374 -1 Left 1128688369 15:69704348-69704370 CCTCTTGGCCTTGGCAGAGCTCT No data
Right 1128688374 15:69704370-69704392 TTTATGTGTTGGGGATGTGTTGG No data
1128688369_1128688373 -10 Left 1128688369 15:69704348-69704370 CCTCTTGGCCTTGGCAGAGCTCT No data
Right 1128688373 15:69704361-69704383 GCAGAGCTCTTTATGTGTTGGGG No data
1128688369_1128688376 7 Left 1128688369 15:69704348-69704370 CCTCTTGGCCTTGGCAGAGCTCT No data
Right 1128688376 15:69704378-69704400 TTGGGGATGTGTTGGCTGCTGGG No data
1128688369_1128688378 30 Left 1128688369 15:69704348-69704370 CCTCTTGGCCTTGGCAGAGCTCT No data
Right 1128688378 15:69704401-69704423 TGATCTTTGCTGGCCTCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128688369 Original CRISPR AGAGCTCTGCCAAGGCCAAG AGG (reversed) Intergenic
No off target data available for this crispr