ID: 1128692656

View in Genome Browser
Species Human (GRCh38)
Location 15:69737015-69737037
Sequence TTGTATCCACAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128692652_1128692656 -8 Left 1128692652 15:69737000-69737022 CCCAATTTCTAAAAATTGTATCC No data
Right 1128692656 15:69737015-69737037 TTGTATCCACAGAAGGAGGAAGG No data
1128692651_1128692656 11 Left 1128692651 15:69736981-69737003 CCAAATAATAGGTGCAGAGCCCA No data
Right 1128692656 15:69737015-69737037 TTGTATCCACAGAAGGAGGAAGG No data
1128692653_1128692656 -9 Left 1128692653 15:69737001-69737023 CCAATTTCTAAAAATTGTATCCA No data
Right 1128692656 15:69737015-69737037 TTGTATCCACAGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128692656 Original CRISPR TTGTATCCACAGAAGGAGGA AGG Intergenic
No off target data available for this crispr