ID: 1128696028

View in Genome Browser
Species Human (GRCh38)
Location 15:69763511-69763533
Sequence CTCCTCGGGATTGTGGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128696028_1128696034 -6 Left 1128696028 15:69763511-69763533 CCATGGACCACAATCCCGAGGAG No data
Right 1128696034 15:69763528-69763550 GAGGAGATACATCAGGGAGTTGG No data
1128696028_1128696035 26 Left 1128696028 15:69763511-69763533 CCATGGACCACAATCCCGAGGAG No data
Right 1128696035 15:69763560-69763582 TTAGTTGTCCCTAAGTTTGATGG No data
1128696028_1128696037 28 Left 1128696028 15:69763511-69763533 CCATGGACCACAATCCCGAGGAG No data
Right 1128696037 15:69763562-69763584 AGTTGTCCCTAAGTTTGATGGGG No data
1128696028_1128696036 27 Left 1128696028 15:69763511-69763533 CCATGGACCACAATCCCGAGGAG No data
Right 1128696036 15:69763561-69763583 TAGTTGTCCCTAAGTTTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128696028 Original CRISPR CTCCTCGGGATTGTGGTCCA TGG (reversed) Intergenic
No off target data available for this crispr