ID: 1128696029 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:69763518-69763540 |
| Sequence | GATGTATCTCCTCGGGATTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1128696029_1128696040 | 30 | Left | 1128696029 | 15:69763518-69763540 | CCACAATCCCGAGGAGATACATC | No data | ||
| Right | 1128696040 | 15:69763571-69763593 | TAAGTTTGATGGGGCCCAGCCGG | No data | ||||
| 1128696029_1128696035 | 19 | Left | 1128696029 | 15:69763518-69763540 | CCACAATCCCGAGGAGATACATC | No data | ||
| Right | 1128696035 | 15:69763560-69763582 | TTAGTTGTCCCTAAGTTTGATGG | No data | ||||
| 1128696029_1128696036 | 20 | Left | 1128696029 | 15:69763518-69763540 | CCACAATCCCGAGGAGATACATC | No data | ||
| Right | 1128696036 | 15:69763561-69763583 | TAGTTGTCCCTAAGTTTGATGGG | No data | ||||
| 1128696029_1128696037 | 21 | Left | 1128696029 | 15:69763518-69763540 | CCACAATCCCGAGGAGATACATC | No data | ||
| Right | 1128696037 | 15:69763562-69763584 | AGTTGTCCCTAAGTTTGATGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1128696029 | Original CRISPR | GATGTATCTCCTCGGGATTG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||