ID: 1128696029

View in Genome Browser
Species Human (GRCh38)
Location 15:69763518-69763540
Sequence GATGTATCTCCTCGGGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128696029_1128696035 19 Left 1128696029 15:69763518-69763540 CCACAATCCCGAGGAGATACATC No data
Right 1128696035 15:69763560-69763582 TTAGTTGTCCCTAAGTTTGATGG No data
1128696029_1128696037 21 Left 1128696029 15:69763518-69763540 CCACAATCCCGAGGAGATACATC No data
Right 1128696037 15:69763562-69763584 AGTTGTCCCTAAGTTTGATGGGG No data
1128696029_1128696036 20 Left 1128696029 15:69763518-69763540 CCACAATCCCGAGGAGATACATC No data
Right 1128696036 15:69763561-69763583 TAGTTGTCCCTAAGTTTGATGGG No data
1128696029_1128696040 30 Left 1128696029 15:69763518-69763540 CCACAATCCCGAGGAGATACATC No data
Right 1128696040 15:69763571-69763593 TAAGTTTGATGGGGCCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128696029 Original CRISPR GATGTATCTCCTCGGGATTG TGG (reversed) Intergenic