ID: 1128696032

View in Genome Browser
Species Human (GRCh38)
Location 15:69763525-69763547
Sequence ACTCCCTGATGTATCTCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128696032_1128696037 14 Left 1128696032 15:69763525-69763547 CCCGAGGAGATACATCAGGGAGT No data
Right 1128696037 15:69763562-69763584 AGTTGTCCCTAAGTTTGATGGGG No data
1128696032_1128696036 13 Left 1128696032 15:69763525-69763547 CCCGAGGAGATACATCAGGGAGT No data
Right 1128696036 15:69763561-69763583 TAGTTGTCCCTAAGTTTGATGGG No data
1128696032_1128696041 24 Left 1128696032 15:69763525-69763547 CCCGAGGAGATACATCAGGGAGT No data
Right 1128696041 15:69763572-69763594 AAGTTTGATGGGGCCCAGCCGGG No data
1128696032_1128696035 12 Left 1128696032 15:69763525-69763547 CCCGAGGAGATACATCAGGGAGT No data
Right 1128696035 15:69763560-69763582 TTAGTTGTCCCTAAGTTTGATGG No data
1128696032_1128696040 23 Left 1128696032 15:69763525-69763547 CCCGAGGAGATACATCAGGGAGT No data
Right 1128696040 15:69763571-69763593 TAAGTTTGATGGGGCCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128696032 Original CRISPR ACTCCCTGATGTATCTCCTC GGG (reversed) Intergenic