ID: 1128696036

View in Genome Browser
Species Human (GRCh38)
Location 15:69763561-69763583
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128696029_1128696036 20 Left 1128696029 15:69763518-69763540 CCACAATCCCGAGGAGATACATC No data
Right 1128696036 15:69763561-69763583 TAGTTGTCCCTAAGTTTGATGGG No data
1128696032_1128696036 13 Left 1128696032 15:69763525-69763547 CCCGAGGAGATACATCAGGGAGT No data
Right 1128696036 15:69763561-69763583 TAGTTGTCCCTAAGTTTGATGGG No data
1128696033_1128696036 12 Left 1128696033 15:69763526-69763548 CCGAGGAGATACATCAGGGAGTT No data
Right 1128696036 15:69763561-69763583 TAGTTGTCCCTAAGTTTGATGGG No data
1128696028_1128696036 27 Left 1128696028 15:69763511-69763533 CCATGGACCACAATCCCGAGGAG No data
Right 1128696036 15:69763561-69763583 TAGTTGTCCCTAAGTTTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128696036 Original CRISPR TAGTTGTCCCTAAGTTTGAT GGG Intergenic