ID: 1128696037

View in Genome Browser
Species Human (GRCh38)
Location 15:69763562-69763584
Sequence AGTTGTCCCTAAGTTTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128696029_1128696037 21 Left 1128696029 15:69763518-69763540 CCACAATCCCGAGGAGATACATC No data
Right 1128696037 15:69763562-69763584 AGTTGTCCCTAAGTTTGATGGGG No data
1128696032_1128696037 14 Left 1128696032 15:69763525-69763547 CCCGAGGAGATACATCAGGGAGT No data
Right 1128696037 15:69763562-69763584 AGTTGTCCCTAAGTTTGATGGGG No data
1128696028_1128696037 28 Left 1128696028 15:69763511-69763533 CCATGGACCACAATCCCGAGGAG No data
Right 1128696037 15:69763562-69763584 AGTTGTCCCTAAGTTTGATGGGG No data
1128696033_1128696037 13 Left 1128696033 15:69763526-69763548 CCGAGGAGATACATCAGGGAGTT No data
Right 1128696037 15:69763562-69763584 AGTTGTCCCTAAGTTTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128696037 Original CRISPR AGTTGTCCCTAAGTTTGATG GGG Intergenic