ID: 1128696040

View in Genome Browser
Species Human (GRCh38)
Location 15:69763571-69763593
Sequence TAAGTTTGATGGGGCCCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128696032_1128696040 23 Left 1128696032 15:69763525-69763547 CCCGAGGAGATACATCAGGGAGT No data
Right 1128696040 15:69763571-69763593 TAAGTTTGATGGGGCCCAGCCGG No data
1128696029_1128696040 30 Left 1128696029 15:69763518-69763540 CCACAATCCCGAGGAGATACATC No data
Right 1128696040 15:69763571-69763593 TAAGTTTGATGGGGCCCAGCCGG No data
1128696033_1128696040 22 Left 1128696033 15:69763526-69763548 CCGAGGAGATACATCAGGGAGTT 0: 1
1: 0
2: 1
3: 13
4: 150
Right 1128696040 15:69763571-69763593 TAAGTTTGATGGGGCCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128696040 Original CRISPR TAAGTTTGATGGGGCCCAGC CGG Intergenic