ID: 1128698663

View in Genome Browser
Species Human (GRCh38)
Location 15:69788140-69788162
Sequence GACCCAAGGCCCCTGAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128698663_1128698667 -3 Left 1128698663 15:69788140-69788162 CCATTCTTCAGGGGCCTTGGGTC No data
Right 1128698667 15:69788160-69788182 GTCCCAGTACTGGGTGCTGCAGG No data
1128698663_1128698670 7 Left 1128698663 15:69788140-69788162 CCATTCTTCAGGGGCCTTGGGTC No data
Right 1128698670 15:69788170-69788192 TGGGTGCTGCAGGCCCCTGTCGG No data
1128698663_1128698671 8 Left 1128698663 15:69788140-69788162 CCATTCTTCAGGGGCCTTGGGTC No data
Right 1128698671 15:69788171-69788193 GGGTGCTGCAGGCCCCTGTCGGG No data
1128698663_1128698672 9 Left 1128698663 15:69788140-69788162 CCATTCTTCAGGGGCCTTGGGTC No data
Right 1128698672 15:69788172-69788194 GGTGCTGCAGGCCCCTGTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128698663 Original CRISPR GACCCAAGGCCCCTGAAGAA TGG (reversed) Intergenic
No off target data available for this crispr