ID: 1128699109

View in Genome Browser
Species Human (GRCh38)
Location 15:69791049-69791071
Sequence GTGTTATGCACCATGAACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128699106_1128699109 5 Left 1128699106 15:69791021-69791043 CCCATTGGTTTCTTTTGGTCTCA No data
Right 1128699109 15:69791049-69791071 GTGTTATGCACCATGAACGGTGG No data
1128699102_1128699109 24 Left 1128699102 15:69791002-69791024 CCTTGGCTGGCTTTATGTCCCCA No data
Right 1128699109 15:69791049-69791071 GTGTTATGCACCATGAACGGTGG No data
1128699101_1128699109 28 Left 1128699101 15:69790998-69791020 CCAGCCTTGGCTGGCTTTATGTC No data
Right 1128699109 15:69791049-69791071 GTGTTATGCACCATGAACGGTGG No data
1128699105_1128699109 6 Left 1128699105 15:69791020-69791042 CCCCATTGGTTTCTTTTGGTCTC No data
Right 1128699109 15:69791049-69791071 GTGTTATGCACCATGAACGGTGG No data
1128699107_1128699109 4 Left 1128699107 15:69791022-69791044 CCATTGGTTTCTTTTGGTCTCAA No data
Right 1128699109 15:69791049-69791071 GTGTTATGCACCATGAACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128699109 Original CRISPR GTGTTATGCACCATGAACGG TGG Intergenic