ID: 1128700066

View in Genome Browser
Species Human (GRCh38)
Location 15:69797474-69797496
Sequence CAGTCTAGGGCTCCCCGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128700055_1128700066 23 Left 1128700055 15:69797428-69797450 CCTAGCCTTGAAGGAATCCGTGG No data
Right 1128700066 15:69797474-69797496 CAGTCTAGGGCTCCCCGAGGTGG No data
1128700058_1128700066 18 Left 1128700058 15:69797433-69797455 CCTTGAAGGAATCCGTGGAGGCT No data
Right 1128700066 15:69797474-69797496 CAGTCTAGGGCTCCCCGAGGTGG No data
1128700060_1128700066 6 Left 1128700060 15:69797445-69797467 CCGTGGAGGCTTACCGGTCTGTA No data
Right 1128700066 15:69797474-69797496 CAGTCTAGGGCTCCCCGAGGTGG No data
1128700054_1128700066 24 Left 1128700054 15:69797427-69797449 CCCTAGCCTTGAAGGAATCCGTG No data
Right 1128700066 15:69797474-69797496 CAGTCTAGGGCTCCCCGAGGTGG No data
1128700061_1128700066 -7 Left 1128700061 15:69797458-69797480 CCGGTCTGTATGAAGCCAGTCTA No data
Right 1128700066 15:69797474-69797496 CAGTCTAGGGCTCCCCGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128700066 Original CRISPR CAGTCTAGGGCTCCCCGAGG TGG Intergenic
No off target data available for this crispr