ID: 1128703625

View in Genome Browser
Species Human (GRCh38)
Location 15:69822216-69822238
Sequence GCACCCCGCTCTGCTGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128703625_1128703629 0 Left 1128703625 15:69822216-69822238 CCTGTGGCAGCAGAGCGGGGTGC No data
Right 1128703629 15:69822239-69822261 CTGCAGGCCATGGCCTCCCCTGG No data
1128703625_1128703636 20 Left 1128703625 15:69822216-69822238 CCTGTGGCAGCAGAGCGGGGTGC No data
Right 1128703636 15:69822259-69822281 TGGGCTTGCTGCCTCCAGTCTGG No data
1128703625_1128703630 1 Left 1128703625 15:69822216-69822238 CCTGTGGCAGCAGAGCGGGGTGC No data
Right 1128703630 15:69822240-69822262 TGCAGGCCATGGCCTCCCCTGGG No data
1128703625_1128703627 -10 Left 1128703625 15:69822216-69822238 CCTGTGGCAGCAGAGCGGGGTGC No data
Right 1128703627 15:69822229-69822251 AGCGGGGTGCCTGCAGGCCATGG No data
1128703625_1128703637 30 Left 1128703625 15:69822216-69822238 CCTGTGGCAGCAGAGCGGGGTGC No data
Right 1128703637 15:69822269-69822291 GCCTCCAGTCTGGATGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128703625 Original CRISPR GCACCCCGCTCTGCTGCCAC AGG (reversed) Intergenic
No off target data available for this crispr