ID: 1128704162

View in Genome Browser
Species Human (GRCh38)
Location 15:69826387-69826409
Sequence CTCCATTTTCAGACGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128704162_1128704167 -5 Left 1128704162 15:69826387-69826409 CCTGGCTGCGTCTGAAAATGGAG No data
Right 1128704167 15:69826405-69826427 TGGAGGCTCTGGGGTGCACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128704162 Original CRISPR CTCCATTTTCAGACGCAGCC AGG (reversed) Intergenic
No off target data available for this crispr