ID: 1128704451

View in Genome Browser
Species Human (GRCh38)
Location 15:69828425-69828447
Sequence CACACTACAGGGCCTCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128704451_1128704457 -5 Left 1128704451 15:69828425-69828447 CCTGGCAGAGGCCCTGTAGTGTG No data
Right 1128704457 15:69828443-69828465 GTGTGGAGAGGGCACAGCAGCGG No data
1128704451_1128704460 3 Left 1128704451 15:69828425-69828447 CCTGGCAGAGGCCCTGTAGTGTG No data
Right 1128704460 15:69828451-69828473 AGGGCACAGCAGCGGGTGGCTGG No data
1128704451_1128704458 -4 Left 1128704451 15:69828425-69828447 CCTGGCAGAGGCCCTGTAGTGTG No data
Right 1128704458 15:69828444-69828466 TGTGGAGAGGGCACAGCAGCGGG No data
1128704451_1128704459 -1 Left 1128704451 15:69828425-69828447 CCTGGCAGAGGCCCTGTAGTGTG No data
Right 1128704459 15:69828447-69828469 GGAGAGGGCACAGCAGCGGGTGG No data
1128704451_1128704462 24 Left 1128704451 15:69828425-69828447 CCTGGCAGAGGCCCTGTAGTGTG No data
Right 1128704462 15:69828472-69828494 GGCCTTTAGCTATGTGTAGGTGG No data
1128704451_1128704461 21 Left 1128704451 15:69828425-69828447 CCTGGCAGAGGCCCTGTAGTGTG No data
Right 1128704461 15:69828469-69828491 GCTGGCCTTTAGCTATGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128704451 Original CRISPR CACACTACAGGGCCTCTGCC AGG (reversed) Intergenic
No off target data available for this crispr