ID: 1128705459

View in Genome Browser
Species Human (GRCh38)
Location 15:69834760-69834782
Sequence GTTTAGGGGTCCAGCCCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128705459_1128705467 12 Left 1128705459 15:69834760-69834782 CCCGGGGGGCTGGACCCCTAAAC No data
Right 1128705467 15:69834795-69834817 CAGACTCTGAGAAATGACAAGGG No data
1128705459_1128705468 13 Left 1128705459 15:69834760-69834782 CCCGGGGGGCTGGACCCCTAAAC No data
Right 1128705468 15:69834796-69834818 AGACTCTGAGAAATGACAAGGGG No data
1128705459_1128705466 11 Left 1128705459 15:69834760-69834782 CCCGGGGGGCTGGACCCCTAAAC No data
Right 1128705466 15:69834794-69834816 GCAGACTCTGAGAAATGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128705459 Original CRISPR GTTTAGGGGTCCAGCCCCCC GGG (reversed) Intergenic
No off target data available for this crispr