ID: 1128705468

View in Genome Browser
Species Human (GRCh38)
Location 15:69834796-69834818
Sequence AGACTCTGAGAAATGACAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128705462_1128705468 -2 Left 1128705462 15:69834775-69834797 CCCTAAACAAAACCCTTCTGCAG No data
Right 1128705468 15:69834796-69834818 AGACTCTGAGAAATGACAAGGGG No data
1128705460_1128705468 12 Left 1128705460 15:69834761-69834783 CCGGGGGGCTGGACCCCTAAACA No data
Right 1128705468 15:69834796-69834818 AGACTCTGAGAAATGACAAGGGG No data
1128705461_1128705468 -1 Left 1128705461 15:69834774-69834796 CCCCTAAACAAAACCCTTCTGCA No data
Right 1128705468 15:69834796-69834818 AGACTCTGAGAAATGACAAGGGG No data
1128705458_1128705468 17 Left 1128705458 15:69834756-69834778 CCTGCCCGGGGGGCTGGACCCCT No data
Right 1128705468 15:69834796-69834818 AGACTCTGAGAAATGACAAGGGG No data
1128705459_1128705468 13 Left 1128705459 15:69834760-69834782 CCCGGGGGGCTGGACCCCTAAAC No data
Right 1128705468 15:69834796-69834818 AGACTCTGAGAAATGACAAGGGG No data
1128705463_1128705468 -3 Left 1128705463 15:69834776-69834798 CCTAAACAAAACCCTTCTGCAGA No data
Right 1128705468 15:69834796-69834818 AGACTCTGAGAAATGACAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128705468 Original CRISPR AGACTCTGAGAAATGACAAG GGG Intergenic
No off target data available for this crispr