ID: 1128705717

View in Genome Browser
Species Human (GRCh38)
Location 15:69836345-69836367
Sequence GAGTGTTGGAAGGATGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128705717_1128705721 8 Left 1128705717 15:69836345-69836367 CCAGCAGCATCCTTCCAACACTC No data
Right 1128705721 15:69836376-69836398 ATGTCTCTTCTCTCTACTGGAGG No data
1128705717_1128705720 5 Left 1128705717 15:69836345-69836367 CCAGCAGCATCCTTCCAACACTC No data
Right 1128705720 15:69836373-69836395 AACATGTCTCTTCTCTCTACTGG No data
1128705717_1128705723 26 Left 1128705717 15:69836345-69836367 CCAGCAGCATCCTTCCAACACTC No data
Right 1128705723 15:69836394-69836416 GGAGGCAGCCTCTGCCCACAGGG No data
1128705717_1128705722 25 Left 1128705717 15:69836345-69836367 CCAGCAGCATCCTTCCAACACTC No data
Right 1128705722 15:69836393-69836415 TGGAGGCAGCCTCTGCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128705717 Original CRISPR GAGTGTTGGAAGGATGCTGC TGG (reversed) Intergenic
No off target data available for this crispr