ID: 1128706727

View in Genome Browser
Species Human (GRCh38)
Location 15:69842318-69842340
Sequence TGTGCTTTCAGGTGCTCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 517}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128706722_1128706727 3 Left 1128706722 15:69842292-69842314 CCTTCTAGCTCTGGTTCTTCTAC 0: 1
1: 0
2: 2
3: 15
4: 188
Right 1128706727 15:69842318-69842340 TGTGCTTTCAGGTGCTCCGGAGG 0: 1
1: 0
2: 0
3: 31
4: 517
1128706720_1128706727 25 Left 1128706720 15:69842270-69842292 CCACTGAAGACTCAGACAGCTTC 0: 1
1: 0
2: 2
3: 22
4: 202
Right 1128706727 15:69842318-69842340 TGTGCTTTCAGGTGCTCCGGAGG 0: 1
1: 0
2: 0
3: 31
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128706727 Original CRISPR TGTGCTTTCAGGTGCTCCGG AGG Intergenic
900162220 1:1229326-1229348 TGTGGTCGCAGCTGCTCCGGTGG - Intronic
900375857 1:2354443-2354465 TGTGGTTCCAGCTACTCCGGAGG + Intronic
900928078 1:5718520-5718542 TGTGCTATCAGCTACTCGGGAGG + Intergenic
901312184 1:8277970-8277992 TGTGGTTCCAGGTACTCAGGAGG - Intergenic
901433300 1:9231448-9231470 TGTAGTTTCAGGTACTCAGGAGG + Intergenic
902389183 1:16092847-16092869 TACACTTTCAGCTGCTCCGGAGG - Intergenic
902595782 1:17508655-17508677 TGTGCTCTCAGCTACTCAGGAGG - Intergenic
902668644 1:17956588-17956610 TGTGGTTCCAGCTACTCCGGAGG - Intergenic
902834886 1:19040620-19040642 TGTGCTCTCAGCTACTCAGGAGG - Intergenic
903100944 1:21029137-21029159 TGTGGTTTCAGCTACTCGGGAGG - Intronic
903676046 1:25065308-25065330 AGTGCATCCAGGTGCTCCTGAGG + Intergenic
903713433 1:25344112-25344134 TGTGGTCCCAGCTGCTCCGGAGG + Intronic
904219914 1:28958695-28958717 TGTGGTTTCAGCTACTCGGGAGG + Intronic
905378207 1:37539586-37539608 TGTACTCTCAGCTGCTCGGGAGG + Intronic
905542062 1:38767764-38767786 TGTGCTCCCAGCTCCTCCGGAGG - Intergenic
905681807 1:39878136-39878158 TGTGTTTTCAGGACCTCCTGGGG + Intronic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
907076899 1:51587241-51587263 TGTGCTTCCAGCTCCTCAGGAGG + Intronic
907520336 1:55019670-55019692 TGTGCCTTCAGCTGCTTCGGGGG - Intergenic
909623961 1:77695198-77695220 TGTGGTCTCAGGTACTCAGGAGG + Intergenic
909640362 1:77865469-77865491 TGTGGTTTCAGTTACTCAGGAGG + Intronic
913657453 1:120974897-120974919 TGTGTTTTCAGCTACTCAGGAGG - Intergenic
915031365 1:152882920-152882942 TGTAATCTCAGGTACTCCGGAGG + Intronic
916608918 1:166371025-166371047 TGTGGTCCCAGCTGCTCCGGAGG + Intergenic
916943890 1:169704645-169704667 TGTGCCTTCAGCTGCTCTGAAGG - Exonic
917569219 1:176247041-176247063 TGTGGTTTCAGCTACTCCGGAGG - Intergenic
918030017 1:180798733-180798755 TGTGATTCCAGGTGCTCAGAAGG - Intronic
918216125 1:182392679-182392701 TTTCCTTTCAGCTGCTCCGGGGG - Intergenic
919393702 1:197019169-197019191 TGTGGTTCCAGCTGCTCAGGAGG - Intergenic
919895418 1:202006911-202006933 TGTGGTTTCAGCTACTCAGGAGG + Intergenic
920015176 1:202901411-202901433 TGTGCTCCCAGCTGCTCAGGAGG - Intronic
920120689 1:203654763-203654785 TGTGCTCTCAGCTACTCAGGAGG + Intronic
920274751 1:204795806-204795828 TGTGCTCTCAGCTACTCAGGAGG - Intergenic
922143840 1:222918218-222918240 TGCGCTTCCAGGTGTTCCTGGGG - Intronic
922441274 1:225656876-225656898 TGTGGTCTCAGCTGCTCAGGAGG + Intergenic
923133300 1:231095962-231095984 TGTGCTTTCAGGGGTCCCCGTGG - Intergenic
924505167 1:244676196-244676218 TGTAGTTTCAGCTGCTCGGGAGG - Intronic
924534909 1:244927271-244927293 TTTGCTTTTAGGTGCACCGTAGG + Intergenic
924547072 1:245039351-245039373 AGTGCTTCCAGCTGCTCAGGAGG + Intronic
1063428718 10:5969492-5969514 TGTGGTCTCAGGTACTCAGGAGG - Intronic
1063755505 10:9002706-9002728 TGTGGTCTCAGCTACTCCGGAGG - Intergenic
1064057969 10:12113796-12113818 TGTGCTGTCAGCTGCTCAGGAGG + Intronic
1064419070 10:15174726-15174748 TGTAGTTTCAGCTGCTCCGGAGG - Intergenic
1065058943 10:21877150-21877172 TGTGGTTTCAGGTACTCAGGAGG + Intronic
1067113107 10:43414682-43414704 TGTGATCTCAGCTGCTCAGGAGG - Intergenic
1069486179 10:68825470-68825492 TGTGGTCCCAGGTACTCCGGAGG + Intergenic
1069497886 10:68923330-68923352 TGTGGTTTCAGGTACTCAGGAGG - Intronic
1069677932 10:70261900-70261922 TGTGGTTCCAGCTGCTCAGGAGG - Intronic
1069817069 10:71204202-71204224 TGTGGTCTCAGCTGCTCAGGAGG + Intergenic
1069969295 10:72152112-72152134 TGTAGTTTCAGCTGCTCAGGAGG - Intronic
1070240685 10:74677121-74677143 TGTGGTTCCAGCTACTCCGGAGG + Intronic
1070262749 10:74873341-74873363 TGTGGTTCCAGCTGCTCAGGAGG + Intronic
1070443010 10:76465164-76465186 TGTGATTTCAAGTGCTCAAGTGG + Intronic
1070580932 10:77718714-77718736 TGTAATCTCAGCTGCTCCGGAGG + Intergenic
1070607138 10:77906744-77906766 TGTACTTCCAGCTGCTCGGGAGG - Intronic
1071247437 10:83780267-83780289 GGTGCTGGTAGGTGCTCCGGTGG - Intergenic
1072167394 10:92827350-92827372 TGTGGTTTCAGCTACTCAGGAGG + Intergenic
1072249388 10:93569528-93569550 TGTGCTGTAAGGTGCTTCCGTGG + Intronic
1072656840 10:97335319-97335341 TGTGGTCCCAGCTGCTCCGGAGG - Intergenic
1073224863 10:101909589-101909611 TGTGGTTTCAGCTACTCAGGCGG - Intronic
1073463547 10:103680398-103680420 TGTGGTTTCAGCTACTCGGGAGG - Intronic
1075843506 10:125525553-125525575 TGTGGTCCCAGCTGCTCCGGAGG - Intergenic
1075944967 10:126424835-126424857 TGTGCTTCTAGATGCTCCAGTGG - Intergenic
1076420315 10:130326968-130326990 TGTGCTGACAGGTGCCCAGGAGG + Intergenic
1076529794 10:131136615-131136637 TGTGATTCCAGCTGCTCGGGAGG - Intronic
1077885297 11:6382913-6382935 TGTGCTCTCAGGGTCTCCTGGGG + Intergenic
1078847452 11:15132405-15132427 TGTGTTTTCAGCTACTCAGGAGG - Intronic
1079016080 11:16870102-16870124 AGGGCTCTCAGGTGCTCAGGTGG - Intronic
1080567472 11:33525290-33525312 TGTATTTTCAGGTTCTCCAGTGG - Intergenic
1080758437 11:35224613-35224635 TGTGGTCTCAGCTGCTCGGGAGG + Intronic
1081507889 11:43737086-43737108 TCTGCATTCAGGTGTTCGGGGGG + Intronic
1081785390 11:45743208-45743230 TGTGGTTCCAGGTACTCGGGAGG + Intergenic
1081851324 11:46277107-46277129 TGTAATTCCAGGTGCTCAGGAGG + Intergenic
1082216528 11:49576818-49576840 TGTGCCTTCAGATGCTCAGCAGG + Intergenic
1082245324 11:49915055-49915077 TGTGGTTCCAGCTGCTCAGGAGG - Intergenic
1083915853 11:65743415-65743437 TGTAGTTCCAGCTGCTCCGGAGG - Intergenic
1084271176 11:68029990-68030012 TGTGGTTCCAGCTGCTCGGGAGG + Intergenic
1084656013 11:70519029-70519051 TGTGGTTTCAGCTGCTCAAGAGG - Intronic
1084687908 11:70708058-70708080 TGTGCTTCCAGGGCCTCAGGAGG + Intronic
1085048378 11:73366606-73366628 TGTGGTTCCAGCTGCTCAGGAGG + Intronic
1085213011 11:74798930-74798952 TGTGGTTTCAGCTACTCAGGAGG + Intronic
1086052916 11:82615189-82615211 TGTAGTTTCAGGTACTCGGGAGG + Intergenic
1086633026 11:89047278-89047300 TGTGCCTTCAGATGCTCAGCAGG - Exonic
1087037407 11:93769084-93769106 TGTAATTTCAGCTACTCCGGAGG + Intronic
1089034567 11:115373461-115373483 TGTAGTCTCAGCTGCTCCGGTGG + Intronic
1089869305 11:121657874-121657896 TGTGATTTCAGCAGCTCTGGGGG - Intergenic
1090798428 11:130155244-130155266 TGTGGTTCCAGCTGCTCGGGAGG - Intergenic
1090998445 11:131888177-131888199 TGTGGTTTCAGCTACTCGGGAGG + Intronic
1091273183 11:134332126-134332148 TGGGCTTCCTGGTGCTCCGCAGG + Exonic
1091461421 12:646312-646334 TGTGCTTTCAGGCCCTCAAGGGG - Intronic
1092252878 12:6910793-6910815 TGTGGTTTCAGCTACTCAGGAGG + Intronic
1092367428 12:7888674-7888696 TGTAGTCTCAGCTGCTCCGGAGG + Intronic
1092699911 12:11216872-11216894 TTTGCTTTCACGTTCTCAGGTGG - Intergenic
1093984456 12:25513512-25513534 TGTGATTTCAGCTACTCGGGAGG + Intronic
1094476995 12:30848264-30848286 TGTGGTCCCAGGTACTCCGGAGG - Intergenic
1095411694 12:41932214-41932236 TGTGGTTCCAGCTGCTCGGGAGG - Intergenic
1096224749 12:49859739-49859761 TGTGGTCCCAGGTGCTCAGGAGG + Intergenic
1097257747 12:57693521-57693543 TGTGGTATCAGCTACTCCGGAGG - Intergenic
1097878196 12:64662903-64662925 TGTGTTTTAAGGGGCTCAGGGGG + Intronic
1098316869 12:69202029-69202051 TGTGTTTCCAGGTGTTCCTGGGG - Intergenic
1100022975 12:90091983-90092005 TGTGCTCTCAGTTACTCAGGAGG + Intergenic
1100636522 12:96439828-96439850 TGTGGTTTCAGCTACTCAGGAGG - Intergenic
1101025473 12:100600103-100600125 TGTGCTCTCAGCTACTCGGGAGG + Intronic
1101911234 12:108861534-108861556 TGTAGTCTCAGGTACTCCGGAGG - Intronic
1102670995 12:114618821-114618843 TGTAATTTCAGCTGCTCGGGAGG + Intergenic
1102864326 12:116361976-116361998 TGTGGTTCCAGGTACTCAGGAGG - Intergenic
1103823332 12:123716186-123716208 TGTGATCTCAGCTGCTCAGGAGG - Intronic
1104004412 12:124882030-124882052 TGTAGTTCCAGCTGCTCCGGAGG + Intronic
1104583091 12:130024954-130024976 TGTGGTTTCAGCTTCTCAGGAGG + Intergenic
1105313667 13:19236677-19236699 TGTGATCTCAGCTGCTCAGGAGG - Intergenic
1105865546 13:24455737-24455759 TGTGGTTTCAGCTTCTCAGGAGG - Intronic
1106678758 13:31988414-31988436 TGTGGTTTCAGCTGCTCACGAGG - Intergenic
1107189329 13:37560557-37560579 TGTGCTTCTAGGTGTTCCTGGGG - Intergenic
1108125495 13:47238557-47238579 TCTGCTTTCAGGGACTCTGGCGG - Intergenic
1108501115 13:51070859-51070881 TATGCTATCAGGTGCTCATGAGG + Intergenic
1109751509 13:66699034-66699056 TGTAATTTCAGCTACTCCGGAGG - Intronic
1110272545 13:73607061-73607083 TGTACTCTCAGCTGCTCAGGAGG - Intergenic
1114334440 14:21673479-21673501 TGTGGTTCCAGCTGCTCAGGAGG + Intergenic
1115790511 14:36872670-36872692 AGTCCTTCCAGGTGCTCCGAAGG - Intronic
1117231994 14:53729247-53729269 TGTGGTTTCAGCTACTCAGGAGG - Intergenic
1117553195 14:56856831-56856853 TGTGTTTTCAGGAGCTCTGATGG + Intergenic
1118469896 14:66066079-66066101 TGGGATTTCCTGTGCTCCGGAGG - Intergenic
1118787613 14:69059204-69059226 TGTGCTCTCAGTTACTCGGGAGG - Intronic
1119265634 14:73262029-73262051 TGTGACTTCAGGTGGTCTGGTGG + Intronic
1119296128 14:73534565-73534587 TGTGGTCCCAGGTGCTCGGGAGG + Intronic
1119300066 14:73564482-73564504 TGTGGTCCCAGGTGCTCAGGAGG + Intergenic
1120240095 14:81939979-81940001 TGTGGTCTCAGCTACTCCGGAGG - Intergenic
1120301109 14:82708221-82708243 TGTGGTCTCAGCTGCTCAGGGGG + Intergenic
1120458474 14:84762956-84762978 TGTGGTTTCAGCTGCTCAGGAGG - Intergenic
1120910374 14:89661210-89661232 TGTGGTCTCAGCTGCTCAGGAGG - Intergenic
1121266641 14:92607492-92607514 TGTGGTTCCAGGTACTCAGGAGG + Intronic
1121454188 14:94027823-94027845 GGTGCTTCCAGATGCTCCAGAGG - Intronic
1122219420 14:100226855-100226877 TGTGCTTCCAGCTACTCAGGAGG + Intergenic
1122514789 14:102299705-102299727 TGTGGTCTCAGGTACTCGGGAGG - Intronic
1122682230 14:103474081-103474103 TGTAGTTTCAGCTACTCCGGAGG + Intronic
1122875995 14:104665703-104665725 TTTGCTTTTAGGTTCTCTGGTGG + Intergenic
1125510870 15:40291668-40291690 TGGGCTGTCAGGTGCTCTGGGGG + Intronic
1126047286 15:44654073-44654095 TGTGGTCTCAGCTACTCCGGAGG - Intronic
1126054081 15:44712878-44712900 TGTGGTCCCAGCTGCTCCGGTGG + Intronic
1127098530 15:55537435-55537457 TGTGGTCTCAGCTGCTCAGGAGG - Intergenic
1127585338 15:60372813-60372835 TGTGCTTCCAGCTACTCAGGAGG - Intronic
1128607740 15:69049310-69049332 TGTGGTTCCAGCTGCTCTGGAGG - Intronic
1128706727 15:69842318-69842340 TGTGCTTTCAGGTGCTCCGGAGG + Intergenic
1128882132 15:71253527-71253549 TGTGATTTCAGCTACTCGGGAGG - Intronic
1129260745 15:74365905-74365927 TGCGCTTTGAGGTGTTACGGGGG - Intronic
1129609929 15:77044958-77044980 TGTGATTTCAGAGGCCCCGGGGG - Exonic
1130265958 15:82403483-82403505 TTTGATCTCAGGTGCTCAGGAGG - Intergenic
1130506060 15:84543395-84543417 TTTGATGTCAGGTGCTCAGGAGG + Intergenic
1130569525 15:85028752-85028774 TGTGCTGGGAGGTGCTCGGGAGG - Intronic
1131036250 15:89224232-89224254 TGTGGTTTCAGCTGCTCAGGAGG - Intergenic
1132538927 16:498638-498660 TGTGGTCTCAGCTGCTCGGGAGG - Intronic
1132807980 16:1784210-1784232 TGTGGTCCCAGGTGCTCAGGAGG - Intronic
1133399780 16:5477134-5477156 TGTGCTTGCAGCTACTCAGGAGG - Intergenic
1133456022 16:5943191-5943213 TGTGAATGCAGGTGCTCCAGGGG - Intergenic
1133811566 16:9164872-9164894 TGTGGTTTCAGCTACTCGGGAGG + Intergenic
1133815799 16:9196511-9196533 TGTGGTCTCAGGTACTCAGGAGG - Intergenic
1134018268 16:10904341-10904363 TGTAATTCCAGCTGCTCCGGAGG - Intronic
1134891159 16:17842927-17842949 TGTGGTTCCAGGTACTCTGGAGG + Intergenic
1135836678 16:25831982-25832004 TGTGGTTCCAGCTGCTCGGGAGG + Intronic
1135859354 16:26041218-26041240 TGTGGTCCCAGCTGCTCCGGAGG + Intronic
1136038494 16:27559560-27559582 TGTGGTTTCAGCTACTCGGGAGG + Intronic
1136341722 16:29648407-29648429 TGTAATTTCAGCTGCTCTGGAGG - Intergenic
1136492882 16:30622085-30622107 TGCGCTTCCAGGTGTTCCTGGGG + Intronic
1136749188 16:32617402-32617424 TGTAGTTTCAGGTACTCGGGAGG + Intergenic
1136843258 16:33555589-33555611 TGTAGTCTCAGCTGCTCCGGAGG - Intergenic
1137398692 16:48135500-48135522 TGTGGTCTCAGGTACTCAGGAGG - Intronic
1137650128 16:50112757-50112779 TGTGATTCCAGCTGCTCAGGAGG + Intergenic
1137774592 16:51044567-51044589 TGTGTTTTCAGGTGCTCATGGGG + Intergenic
1138021439 16:53485732-53485754 TGTGGTTCCAGCTACTCCGGAGG + Intronic
1138430686 16:56966719-56966741 TGTGGTTCCAGCTGCTCGGGAGG - Intronic
1138511616 16:57511951-57511973 TGTGATTTCAGCTACTCAGGAGG - Intergenic
1138694749 16:58802633-58802655 TGTGATTTCAGCTACTCAGGGGG - Intergenic
1138788093 16:59869829-59869851 TGTGGTCCCAGGTACTCCGGAGG + Intergenic
1139282477 16:65782797-65782819 TTTGCTTTCAGAGGCTCCAGAGG - Intergenic
1139326785 16:66158752-66158774 TGTGGTTCCAGGTACTCAGGAGG + Intergenic
1140198116 16:72872577-72872599 TGTAGTCTCAGGTACTCCGGAGG - Intronic
1140203711 16:72915639-72915661 TGTGGTTCCAGCTACTCCGGAGG + Intronic
1140227040 16:73086779-73086801 TGTGCTCTCAGCTACTCGGGAGG + Intergenic
1141198002 16:81876145-81876167 TGTGGTCCCAGGTACTCCGGAGG - Intronic
1141240411 16:82260368-82260390 TGTGGTCTCAGCTACTCCGGAGG - Intergenic
1141751813 16:85963272-85963294 TGTGGTTTCAGCTGTTCCGGAGG + Intergenic
1141852553 16:86657314-86657336 TGTGTTTTCAGCTACTCAGGAGG - Intergenic
1142266373 16:89065699-89065721 TGGGCTTCCAGGTTCCCCGGAGG + Intergenic
1142298426 16:89242062-89242084 TGTGCTTCCAGGTATTCTGGAGG + Intergenic
1142318969 16:89368782-89368804 TGTGGTTTCAGCTACTCCAGAGG + Intronic
1142323256 16:89398618-89398640 TGTGGTTTCAGATACTCAGGGGG + Intronic
1142398240 16:89845192-89845214 TGAGCTTTCTGGTGTTCCGGCGG + Intronic
1203051322 16_KI270728v1_random:876616-876638 TGTAGTTTCAGGTACTCGGGAGG + Intergenic
1203153423 16_KI270728v1_random:1855887-1855909 TGTAGTCTCAGCTGCTCCGGAGG - Intergenic
1143337557 17:6184549-6184571 TGTAATTCCAGCTGCTCCGGAGG + Intergenic
1143470613 17:7173046-7173068 TGTGATCTCAGGTACTCGGGAGG + Intergenic
1143641239 17:8198958-8198980 TGTGGTTCCAGCTGCTCCAGAGG + Intergenic
1143647943 17:8243944-8243966 TGTGCTTCCAGCTACTCGGGAGG + Intronic
1143989346 17:10943502-10943524 TGTGGTTTCAGCTACTCAGGAGG + Intergenic
1144780289 17:17804778-17804800 TGTGGTCTCAGCTGCTCAGGAGG - Intronic
1145757448 17:27403121-27403143 TGTGGTTTCAGCTACTCCAGAGG - Intergenic
1146392832 17:32438637-32438659 TGTGATCTCAGGTACTCGGGAGG + Intergenic
1146757662 17:35447976-35447998 TGTGGTTCCAGCTTCTCCGGAGG - Intronic
1147223013 17:38951020-38951042 TGTAGTTTCAGCTGCTCAGGAGG - Intronic
1147265202 17:39230695-39230717 TGAGCTTTCAGCTGCTCCTCAGG + Intergenic
1147811926 17:43177149-43177171 TGTGGTTCCAGCTACTCCGGAGG + Intronic
1147913645 17:43873410-43873432 TGTGCTTCCAGGTGTTCCTGGGG - Intergenic
1148059311 17:44824418-44824440 TGTGGTTTCAGCTACTCAGGAGG - Intronic
1148440976 17:47711448-47711470 TGTGGTGTCAGGGGCTCCAGTGG - Exonic
1148551227 17:48551810-48551832 GGAGCTTTCAGAAGCTCCGGTGG + Intronic
1148738207 17:49876711-49876733 TGTGCTCTCAGCTACTCAGGCGG + Intergenic
1149149157 17:53538464-53538486 TGTGGTTTCAGCTACTCCAGAGG - Intergenic
1149329050 17:55562632-55562654 TGTAATTTCAGGTACTCAGGAGG + Intergenic
1149480957 17:57002747-57002769 TGTGGTCTCAGCTGCTCAGGAGG + Intronic
1149481174 17:57004266-57004288 TGTGGTCTCAGCTGCTCTGGAGG + Intronic
1149496909 17:57124640-57124662 TGTGCTCCCAGCTGCTCAGGAGG - Intergenic
1149567891 17:57652616-57652638 GCTGCTTTCAGGGGCTCTGGGGG - Intronic
1149782988 17:59412788-59412810 TGTGGTTTCAGCTACTCAGGAGG - Intergenic
1149923806 17:60682642-60682664 TGTAATTTCAGCTGCTCGGGAGG - Intronic
1150801348 17:68285546-68285568 TGTGCTTCCAGCTACTCGGGAGG + Intronic
1151514841 17:74586624-74586646 TGAGCTTCCAGGTGTTCCTGGGG - Intronic
1151926298 17:77200042-77200064 TGTGGTTCCAGCTGCTCAGGAGG + Intronic
1152414229 17:80148344-80148366 TGTGGTCCCAGGTGCTCTGGAGG - Intergenic
1152819671 17:82430507-82430529 TGTAATCTCAGGTGCTCAGGAGG - Intronic
1153302098 18:3600039-3600061 TGTGGTTCCAGCTGTTCCGGAGG - Intronic
1153854706 18:9135256-9135278 TGTGCTCCCAGCTGCTCAGGAGG - Intergenic
1154167921 18:12029760-12029782 TGAGCCTTCAGGTGCTCTAGTGG - Intronic
1154318080 18:13321737-13321759 TGTAATTTCAGCTGCTCGGGAGG + Intronic
1155128033 18:22900216-22900238 TGTGGTTCCAGCTGCTCAGGAGG + Intronic
1156348868 18:36285619-36285641 TGTGGTTTCAGCTACTCTGGAGG + Intergenic
1156947850 18:42856948-42856970 TGTGGTCCCAGCTGCTCCGGAGG - Intronic
1157262489 18:46188320-46188342 TGTAATTCCAGCTGCTCCGGAGG - Intronic
1159168858 18:64736710-64736732 TGTGCTTTCAGGGCCTGCTGAGG - Intergenic
1159224657 18:65517162-65517184 TGTACTTCCAGCTGCTCAGGAGG - Intergenic
1159675401 18:71278175-71278197 TGTAGTTCCAGGTGCTCAGGAGG - Intergenic
1159675728 18:71282709-71282731 TGTGATTTCAGCTACTCAGGAGG - Intergenic
1160220646 18:76975030-76975052 TGTACTTTCAGCTGCTCAGGAGG - Intergenic
1160520958 18:79507662-79507684 TGTCCTTTCTAGGGCTCCGGGGG - Intronic
1160610973 18:80084793-80084815 TGTGCTTCCAGCTACTCAGGAGG + Intronic
1160840578 19:1145349-1145371 TGTGGTCTCAGCTGCTCGGGAGG + Intronic
1161098429 19:2407737-2407759 TGTGGTTTCAGCTCCTCAGGAGG - Intronic
1161205382 19:3038328-3038350 TGTGATTCCAGCTACTCCGGAGG - Intronic
1161476044 19:4485929-4485951 TGTAGTTTCAGCTGCTCAGGAGG + Intronic
1161654458 19:5505445-5505467 TGTAATCTCAGCTGCTCCGGAGG + Intergenic
1162075458 19:8183890-8183912 TGTGGTTCCAGGTCCTCGGGGGG - Intronic
1162305912 19:9873574-9873596 TGTGGTCTCAGCTACTCCGGAGG - Intronic
1162318794 19:9958586-9958608 TGTGGTTTCAGCTACTCAGGAGG - Intergenic
1162843191 19:13371496-13371518 TTTGCTTTCAGGAGCTCATGGGG + Intronic
1163246100 19:16095403-16095425 TGGGCTTCTAGGAGCTCCGGTGG + Intronic
1163590314 19:18189959-18189981 TGTGATTCCAGCTACTCCGGAGG - Intergenic
1163771922 19:19196438-19196460 TGTAGTTTCAGCTGCTCAGGAGG + Intronic
1164013946 19:21235329-21235351 TGCGCTTCCAGGTGTTCCTGGGG - Intronic
1164242640 19:23403482-23403504 TGTAATTTCAGCTACTCCGGGGG - Intergenic
1165017965 19:32897681-32897703 TGTGGTTTCAGCTACTCAGGAGG - Intronic
1165421520 19:35724374-35724396 TGTGGTCTCAGCTGCTCAGGAGG + Intronic
1165495160 19:36148393-36148415 TGTGGTCTCAGTTGCTCGGGAGG + Intronic
1166705826 19:44907473-44907495 TGTGCTCTCAGCTACTCAGGAGG + Intronic
1166815624 19:45543440-45543462 TGTAATCTCAGGTACTCCGGGGG - Intronic
1167068411 19:47204626-47204648 TGTACTCTCAGCTGCTCGGGAGG - Intronic
1167842893 19:52136357-52136379 TGTAATCTCAGGTGCTTCGGAGG + Intronic
1167847029 19:52172992-52173014 TGTGGTCCCAGCTGCTCCGGAGG + Intergenic
1168015930 19:53573095-53573117 TGTGATCTCAGCTACTCCGGAGG + Intronic
1168087108 19:54056341-54056363 TGTGCTTTCAGCTACTCGGGAGG - Intronic
1168248701 19:55128293-55128315 TGTGGTCCCAGCTGCTCCGGAGG - Intergenic
1168620152 19:57871985-57872007 TGTGGTTTCAGCTACTCAGGAGG + Intronic
1168649245 19:58082787-58082809 TGTGATTTCAGCTACTCAGGAGG - Intronic
925361338 2:3282605-3282627 TGTGCTTTGATGGGCTCTGGGGG + Intronic
927685931 2:25170374-25170396 TGTGGTTCCAGGTACTCAGGAGG - Intergenic
928377496 2:30787576-30787598 TGTGCTTTCACGTGCACAAGAGG + Intronic
929022066 2:37563264-37563286 TGAGCTTTGAGGAGCTCTGGTGG + Intergenic
929495120 2:42434332-42434354 TGTGCTTCCAGCTGCTCAGGAGG + Intergenic
930127328 2:47811861-47811883 TGTACTTCCAGCTGCTCTGGAGG - Intronic
930679504 2:54241401-54241423 TATGCACTCAGGTGCTCAGGAGG + Intronic
931097874 2:58962278-58962300 TGTGGTTTCAGCTACTCAGGAGG + Intergenic
931664457 2:64600288-64600310 CATGCCTTCAGGTGCTCCTGTGG - Intergenic
933246558 2:79982158-79982180 TGTGGTCTCAGGTACTCTGGAGG - Intronic
933522615 2:83392247-83392269 TGTAGTTTCAGCTGCTCTGGAGG + Intergenic
933673781 2:85034741-85034763 TGTAATCTCAGCTGCTCCGGAGG - Intronic
933723185 2:85410980-85411002 TGTGGTGTCAGCTGCTCAGGAGG - Intronic
933744722 2:85562110-85562132 TGTGGTTTCAGCTACTCGGGAGG + Intronic
934905448 2:98197267-98197289 TGTGCCTTCAGGTGATCCACTGG - Intronic
935179130 2:100674806-100674828 TGTTCTTCCAGGAGCTCCAGTGG + Intergenic
935435747 2:103030170-103030192 TGTGATTCCAGGTACTCGGGAGG - Intergenic
936133973 2:109873400-109873422 TGTACTTTCAGCTACTCGGGAGG - Intergenic
936166182 2:110121611-110121633 TGTGCTCTCAGCTACTCAGGAGG + Intergenic
936210724 2:110498085-110498107 TGTACTTTCAGCTACTCGGGAGG + Intergenic
936435253 2:112499191-112499213 TGTACTTTCAGCTACTCGGGAGG + Intronic
937414426 2:121703093-121703115 TGTGGTTCCAGCTACTCCGGAGG - Intergenic
937923770 2:127152021-127152043 TGTAGTTTCAGGTACTCAGGGGG - Intergenic
938069171 2:128299526-128299548 TGTGCCTTCAGCTGCTGCTGTGG - Intronic
938088310 2:128416382-128416404 TGTGCTTTCAGGTGCAGTGCTGG + Intergenic
938794093 2:134704147-134704169 GCTTCTTTCAGGTGCTCCAGGGG + Intronic
939791988 2:146588981-146589003 TGTGCTTTAAGATGCTGCTGAGG - Intergenic
940624095 2:156150486-156150508 TGTAGTTTCAGTTGCTCAGGAGG + Intergenic
943074680 2:183179574-183179596 TGGGGTTTCAGGCGCTCCTGGGG + Intergenic
943081793 2:183265273-183265295 TGTGGTCTCAGCTGCTCGGGAGG + Intergenic
943245804 2:185450118-185450140 TGTGGTCACAGCTGCTCCGGAGG - Intergenic
943631632 2:190259478-190259500 TGTGGTTCCAGCTGCTCAGGAGG - Intronic
944429437 2:199617222-199617244 TGTCCTTTCATGTGCTTCTGGGG + Intergenic
944469686 2:200039789-200039811 TGTGCTTCCAAGTGCTCTGGGGG - Intergenic
945051115 2:205825125-205825147 TGTGCTTCCAGCTACTCAGGAGG + Intergenic
945252545 2:207776741-207776763 TGTGGTTCCAGCTGCTCAGGAGG + Intergenic
946100467 2:217316060-217316082 TATGCTTTCTGGGGCTCCAGAGG + Intronic
946222166 2:218237319-218237341 TGTGGTCCCAGGTACTCCGGAGG - Intronic
946224710 2:218258076-218258098 TGTGGTCCCAGGTACTCCGGAGG - Intergenic
946234402 2:218314341-218314363 TGTGCTTCCAGCTGCTCAGGAGG - Intronic
947285812 2:228513002-228513024 TGTGGTTCCAGCTGCTCAGGAGG + Intergenic
947547721 2:231022680-231022702 TGTGATTTCAGCTACTCCGGAGG + Intronic
947638650 2:231693777-231693799 TGTAGTTTCAGGTGCTCAGCTGG + Intergenic
948176581 2:235948302-235948324 TGTGGTCCCAGGTTCTCCGGAGG - Intronic
949048628 2:241885023-241885045 TGTAGTTTCAGCTGCTCGGGAGG + Intergenic
1169166211 20:3426311-3426333 TGTGGTCCCAGGTGCTCAGGAGG + Intergenic
1169333739 20:4737909-4737931 TGTAATTTCAGCTACTCCGGAGG + Intronic
1170225900 20:13991869-13991891 TGTAGTTTCAGGTACTCAGGAGG + Intronic
1170620456 20:17991423-17991445 TGTAGTCCCAGGTGCTCCGGAGG + Intronic
1171731309 20:28703931-28703953 AGTGCTTTCAGGTTCTGTGGTGG + Intergenic
1171732538 20:28726775-28726797 AGTGCTTTCAGGTTCTGTGGTGG + Intergenic
1172048227 20:32096621-32096643 TGTAGTTTCAGGTACTCAGGAGG - Intronic
1172161024 20:32868178-32868200 TGTAGTTTCAGCTACTCCGGGGG - Intronic
1172291067 20:33777199-33777221 TGTGGTCTCAGCTGCTCAGGAGG + Intronic
1172418300 20:34790474-34790496 TGTGGTCTCAGCTGCTCGGGAGG - Intronic
1172710592 20:36920234-36920256 TGTGGTTTCAGCTACTCGGGAGG - Intronic
1172913637 20:38428248-38428270 TGTGCCTTCAGGGGCTGTGGAGG - Intergenic
1172952783 20:38732526-38732548 TGTGGTGTCAGTTGCTCGGGGGG - Intergenic
1172958009 20:38775652-38775674 TGTGGTTCCAGCTGCTCAGGAGG + Intergenic
1173208606 20:41014251-41014273 TGTGATCTCAGCTGCTCGGGAGG + Intergenic
1173253293 20:41375758-41375780 GGTGCCTTCAGGTACCCCGGGGG + Intergenic
1173518990 20:43685300-43685322 TGTAATCTCAGCTGCTCCGGAGG - Intronic
1173790245 20:45823609-45823631 TGTGGTCCCAGTTGCTCCGGGGG - Intronic
1174586705 20:51614420-51614442 TGTGCTCCCAGCTGCTCAGGAGG - Intronic
1174730032 20:52907110-52907132 TGTACTTCCAGCTGCTCAGGAGG + Intergenic
1174829342 20:53798256-53798278 TGTGATTTCAGCTGCTCGGAAGG - Intergenic
1175131358 20:56792016-56792038 TGTGCTCTCAGGTGCTAGGCAGG + Intergenic
1175187933 20:57191278-57191300 TGTGCTCTGGGGTGCTCCAGAGG + Intronic
1176022656 20:62970087-62970109 TGTGGTTCCAGCTGCTCGGGAGG - Intergenic
1177518850 21:22190677-22190699 TGTGGTCTCAGCTACTCCGGAGG + Intergenic
1178809285 21:35866690-35866712 TGTGCTTTCAAATACTCTGGGGG - Intronic
1178870925 21:36374671-36374693 TGTGCTTCCAGCTACTCAGGAGG + Intronic
1179582065 21:42350409-42350431 TGTGGTTTCAGCTACTCAGGCGG + Intronic
1179977397 21:44876250-44876272 TGTGGTCTCAGCTGCTCGGGAGG - Intergenic
1179992439 21:44955092-44955114 TGTAATTCCAGCTGCTCCGGAGG + Intronic
1181548235 22:23617646-23617668 TGTGCTTCCAGGTTCTTCTGAGG - Exonic
1182139885 22:27944819-27944841 TGTGATCCCAGGTACTCCGGAGG + Intergenic
1182249813 22:28991158-28991180 TGTGGTTTCAGCTACTCGGGAGG + Intronic
1182312318 22:29418050-29418072 TGTAATTTCAGCTGCTCAGGAGG - Intronic
1182333882 22:29570354-29570376 TGCCCTTTCAGGGGCTCTGGGGG - Intronic
1182360943 22:29746092-29746114 TGTGGTTCCAGCTGCTCAGGAGG - Intronic
1182687944 22:32135191-32135213 TGTAATTTCAGCTGCTCGGGAGG + Intergenic
1183657871 22:39200603-39200625 TGTGGTTCCAGCTACTCCGGAGG - Intergenic
1183848778 22:40565423-40565445 TGTACTCTCAGTTACTCCGGGGG + Intronic
1184319205 22:43726447-43726469 TCTGCTTTCAGTTGCTCCCCAGG - Intronic
1185231157 22:49684539-49684561 TGTGATCTCAGCTGCTCAGGAGG - Intergenic
949096985 3:97858-97880 TGTGCTTTGAGGTGTGCCAGTGG - Intergenic
950707289 3:14790892-14790914 TGTGGTTTCAGCTACTCGGGAGG - Intergenic
951029966 3:17870494-17870516 TGTAATCTCAGCTGCTCCGGAGG - Intronic
951260749 3:20504656-20504678 TGTGTTTTCAGATTCTCCAGTGG + Intergenic
952065432 3:29563893-29563915 TGTGGTTTCAGCTCCTCAGGAGG + Intronic
952915327 3:38233788-38233810 TGTGGTTCCAGCTGCTCAGGAGG + Intronic
953472011 3:43175720-43175742 TGTTCTTCCAGGTGCTCCAGTGG - Intergenic
953497980 3:43404760-43404782 TGTGGTCTCAGGTACTCAGGAGG + Intronic
953641885 3:44715826-44715848 TGTGGTTTCAGCTACTCAGGAGG - Intronic
954287993 3:49632680-49632702 TGTGCTCCCAGCTGCTCGGGTGG + Intronic
954344934 3:49988838-49988860 TGTGGTACCAGGTACTCCGGAGG + Intronic
956820490 3:72949631-72949653 TGTGGTCTCAGCTACTCCGGAGG - Intronic
957093865 3:75759395-75759417 TGTACTTCCAGCTACTCCGGAGG - Intronic
957614810 3:82512866-82512888 TGTGATCCCAGGTACTCCGGAGG - Intergenic
957818198 3:85330838-85330860 TGTGGTTTCAGCTACTCAGGAGG + Intronic
957943076 3:87029511-87029533 TGTGCTTTCAGCTACTCAGGAGG + Intergenic
958001047 3:87749285-87749307 TGTGCTTACAAGTGCTCCCAGGG + Intergenic
958880429 3:99663285-99663307 TGTAGTTTCAGCTGCTCGGGAGG - Intronic
959404425 3:105942903-105942925 TGTAGTCTCAGGTACTCCGGAGG + Intergenic
959435693 3:106312446-106312468 TGTGGTCCCAGCTGCTCCGGAGG - Intergenic
960809227 3:121612457-121612479 TGTAAGTTCAAGTGCTCCGGAGG - Intronic
961167399 3:124773025-124773047 TGTAATCTCAGCTGCTCCGGAGG - Intronic
961697766 3:128717723-128717745 TGTGGTTCCAGGTACTCGGGAGG + Intergenic
961698368 3:128722545-128722567 TGTACTTCCAGCTGCTCGGGTGG + Intergenic
963778742 3:149465644-149465666 TGTGCTTCCAGCTGCTCAGTGGG + Intergenic
964349312 3:155787318-155787340 TGTGGTCTCAGCTGCTCAGGAGG - Intronic
965594899 3:170400930-170400952 TGTGGTCACAGCTGCTCCGGAGG - Intergenic
965861282 3:173154063-173154085 TGTGGTTCCAGCTGCTCAGGAGG - Intergenic
966606410 3:181825702-181825724 TGTAATTTCAGGTACTCAGGAGG - Intergenic
967696501 3:192538066-192538088 TGTAATCTCAGGTGCTCAGGAGG - Intronic
968635276 4:1675293-1675315 TGTGCTTCCCGGAGCTCAGGTGG - Intronic
968711542 4:2123034-2123056 TGTGGTCTCAGGTACTCAGGAGG + Intronic
968789464 4:2649548-2649570 TGTGGTTTCAGCTACTCGGGAGG + Intronic
970258889 4:14202300-14202322 TGTGATTTCAGTTACTCAGGAGG + Intergenic
970880769 4:20927098-20927120 TGTAGTTTCAGCTACTCCGGAGG - Intronic
971350734 4:25853791-25853813 TGTGATCTCAGCTGCTCAGGAGG - Intronic
972927488 4:44029198-44029220 TGTGCGTTCAGGTACTCCTTTGG - Intergenic
972935475 4:44129258-44129280 TGTGCTCCCAGGTACTCGGGAGG + Intergenic
973114914 4:46443926-46443948 AGTGGTTTCAGTTGCTCTGGAGG + Intronic
975246958 4:72130767-72130789 TCTGCTTTCTGGGGCTCCAGGGG - Intronic
975959348 4:79882306-79882328 TGTAGTTTCAGCTGCTCGGGAGG + Intergenic
976295344 4:83465664-83465686 TGTGGTTTCAGCTACTCTGGAGG + Intronic
976709665 4:88055456-88055478 TGTGGTTTCAGCTACTCAGGAGG - Intronic
977510429 4:97955334-97955356 TGTAGTTTCAGCTGCTCAGGAGG - Intronic
978455324 4:108883161-108883183 TGTGATCTCAGCTGCTCAGGAGG - Intronic
979429375 4:120610268-120610290 TGTGGTTTCAGATACTCAGGAGG - Intergenic
979511528 4:121559467-121559489 TGTGCTTTCTGTTTCTCCAGGGG - Intergenic
980452232 4:132989171-132989193 TGTAGTTTCAGCTACTCCGGAGG - Intergenic
981606420 4:146545842-146545864 GGGGCTTTCAGTTGCTCCTGCGG + Intergenic
982082991 4:151808207-151808229 TGTTCCTTCAGCTGCTCCGGGGG - Intergenic
982464242 4:155710531-155710553 TGTGATTTCAGGAGTTCCAGTGG + Exonic
983726183 4:170929651-170929673 TGTGGTTTCAGCTACTCCAGAGG + Intergenic
983894652 4:173068922-173068944 TGTACTTTCAGGTTCTGCAGTGG + Intergenic
984030487 4:174598144-174598166 TGTAATTTCAGCTGCTCAGGAGG + Intergenic
984890598 4:184489446-184489468 TGTGGTCTCAGCTGCTCGGGAGG - Intergenic
984924212 4:184792558-184792580 TGTGGTTTCAGCTACTCAGGAGG - Intronic
985253161 4:188043160-188043182 TGTGATCTCAGCTACTCCGGAGG + Intergenic
985600171 5:824337-824359 TGTACTTTCAGCTACTCAGGAGG + Intronic
985941483 5:3140028-3140050 TGTGCTTCCAGCTACTCAGGAGG + Intergenic
987808277 5:22798993-22799015 TGTGGTTTCAGGTACTTGGGAGG + Intronic
987899567 5:23993935-23993957 TGTGGTCCCAGCTGCTCCGGAGG + Intronic
990213410 5:53504953-53504975 TGTACTCTCAGGTACTCAGGAGG + Intergenic
990874414 5:60468258-60468280 TGTGGTTCCAGGTACTCAGGAGG - Intronic
991113069 5:62923608-62923630 TGTGGTCTCAGCTGCTCAGGAGG + Intergenic
992027650 5:72686505-72686527 TGGGCTTTGAGGTGCCCCGGGGG + Intergenic
993966701 5:94368292-94368314 TGTGGTTCCAGCTACTCCGGGGG - Intronic
994253445 5:97564136-97564158 TGTAATCTCAGCTGCTCCGGAGG + Intergenic
995139330 5:108716829-108716851 TGTGGTCTCAGGTACTCAGGAGG + Intergenic
995274799 5:110265894-110265916 TGTCCTTTCAGGTGGTCCAAAGG - Intergenic
995712536 5:115049834-115049856 TCTGCTTTCAGGTGCCCCCAAGG + Intergenic
998099244 5:139418272-139418294 TGTGGTTTCAGCTACTCAGGAGG - Intronic
998276163 5:140755116-140755138 TGTGGTTTCAGCTGCTCAAGAGG - Intergenic
998504692 5:142662943-142662965 TGTGCTTCCAGCTGCTTGGGAGG - Intronic
998779496 5:145640520-145640542 TGTGCTTCCGGCTGCTCCAGAGG + Intronic
999877008 5:155818640-155818662 TGTGGTCTCAGCTGCTCAGGAGG - Intergenic
1000309499 5:160028593-160028615 TGTGGTTTCAGCTACTCTGGAGG - Intronic
1000720559 5:164701107-164701129 TGTGCTTCCAGCTACTCTGGAGG + Intergenic
1001211377 5:169813053-169813075 TGTCCTTTCAGGGGCTCCTGCGG + Intronic
1001382975 5:171315990-171316012 TGTGGTTCCAGCTACTCCGGAGG + Intergenic
1001409061 5:171497373-171497395 TGTGATTCCAGCTACTCCGGAGG - Intergenic
1001852649 5:174983066-174983088 TGTGGTTTCAGCTACTCAGGAGG - Intergenic
1002543298 5:179920646-179920668 TTTGCTTTGAGGAGCTCCAGTGG - Intronic
1004238260 6:13895131-13895153 TGTGGTTTCAGCTACTCAGGAGG + Intergenic
1004813646 6:19288491-19288513 TGTACTCTCAGCTGCTCAGGAGG - Intergenic
1005032010 6:21518152-21518174 TGTACTCTCAGGTACTCAGGAGG + Intergenic
1005590546 6:27321114-27321136 TGTAATTCCAGCTGCTCCGGAGG - Intergenic
1005668377 6:28080497-28080519 TGTAGTTCCAGGTGCTCGGGAGG - Intergenic
1006262258 6:32884916-32884938 TGTGGTTTCAGCTACTCAGGAGG - Intergenic
1006356171 6:33559462-33559484 TGTGGTTACAGGTACTCCGGAGG + Intergenic
1006873115 6:37271189-37271211 TGTAATTTCAGCTACTCCGGAGG + Intronic
1007775171 6:44220999-44221021 TGTGGTTCCAGGTACTCCAGAGG - Intronic
1008708105 6:54187883-54187905 TGTACTCTCAGGTATTCCGGAGG + Intronic
1009518655 6:64653684-64653706 TGTGGTTTCAGCTACTCAGGAGG - Intronic
1010284146 6:74055505-74055527 TGTGGTTCCAGCTGCTCAGGAGG + Intergenic
1011051810 6:83159393-83159415 TGTGGTCTCAGCTGCTCAGGAGG - Intronic
1012187820 6:96243164-96243186 TGTAGTTTCAGTTACTCCGGAGG + Intergenic
1012964742 6:105661402-105661424 TGTGGTTTCAGCTACTCAGGAGG + Intergenic
1013526421 6:110978327-110978349 TGTGATTTCAGCTACTCGGGAGG + Intergenic
1014203819 6:118633324-118633346 TGTAGTCTCAGCTGCTCCGGAGG - Intronic
1014517099 6:122393299-122393321 TGTGCTCTCAGCTACTCCGGAGG - Intergenic
1015562677 6:134533493-134533515 TGTGCTTTCAGGCCCTGCTGAGG - Intergenic
1015746582 6:136516281-136516303 TGTGGTCTCAGCTACTCCGGAGG - Intronic
1016741458 6:147533338-147533360 TGTAATTTCAGCTACTCCGGAGG + Intronic
1017742179 6:157416545-157416567 TGTGGTCCCAGCTGCTCCGGAGG + Intronic
1018127133 6:160692434-160692456 TGTGCTTTTTGGTGCTGTGGTGG - Intergenic
1018208803 6:161460586-161460608 TGTGCTGGCAGGAGTTCCGGGGG + Intronic
1018984462 6:168625723-168625745 TTTGCTTTCATTTGCTCCTGGGG - Intronic
1019009835 6:168835326-168835348 TGTGCTTTCAGGTGCCAGGAAGG - Intergenic
1019195010 6:170276089-170276111 TGTGGTTTCAGCTACTCAGGAGG + Intergenic
1019327462 7:445467-445489 TGACCTTTCAGGTTCTCCAGTGG + Intergenic
1019430657 7:997489-997511 AGGGCTTTCAGCTCCTCCGGTGG - Exonic
1019456333 7:1129565-1129587 TGTGGTTACAGCTGCTCAGGAGG - Intronic
1019553547 7:1617140-1617162 TGTGCTTTCAAGTGGACAGGAGG + Intergenic
1019698039 7:2458634-2458656 TGTAGTTTCAGCTGCTCTGGAGG + Intergenic
1019832465 7:3346465-3346487 TGTGCTTTCTGGTGCCCTTGTGG + Intronic
1021592096 7:22274449-22274471 TGTCCTCTCAGGTACTCGGGAGG - Intronic
1022729934 7:33012967-33012989 TGTGGTTCCAGGTACTCAGGAGG - Intergenic
1024285706 7:47755868-47755890 TGAGCGTTCAGGAGCTCCAGCGG + Intronic
1025783688 7:64624108-64624130 TGTGATTTCAGCTACTCGGGAGG + Intergenic
1026172387 7:67965324-67965346 TGTGGTCTCAGGTACTCAGGAGG + Intergenic
1026184160 7:68068796-68068818 TGTGGTTCCAGCTGCTCAGGAGG + Intergenic
1026619847 7:71940731-71940753 TGTGGTTTCAGCTACTCGGGAGG - Intronic
1026949513 7:74338079-74338101 TGTGGTTTCAGCTACTCGGGAGG + Intronic
1027408385 7:77886922-77886944 TGTGGTCCCAGGTGCTCAGGAGG + Intronic
1027560234 7:79719689-79719711 TGTGCCTTCAGGTGCACAGAAGG - Intergenic
1028120224 7:87049401-87049423 TGTGGTTCCAGCTGCTCGGGAGG - Intronic
1028298106 7:89161162-89161184 TGTGCTTTCACAGGCTGCGGAGG - Intronic
1028666832 7:93354413-93354435 TGTAGTTTCAGCTGCTCAGGAGG - Intronic
1029046417 7:97634035-97634057 TGTAGTTTCAGCTGCTCTGGAGG + Intergenic
1029508886 7:100980794-100980816 TGTGGTCTCAGGTACTCTGGAGG + Intronic
1029665429 7:101992194-101992216 TGTGCTTTAAGGAGCTCAGTAGG - Intronic
1030010435 7:105161045-105161067 TGTAGTTTCAGCTGCTCGGGAGG - Intronic
1030358302 7:108568325-108568347 TGTGATCTCAGCTGCTCGGGAGG - Intronic
1032681586 7:134190326-134190348 TGTGGTCTCAGCTGCTCAGGAGG - Intronic
1033201931 7:139380476-139380498 TGTGATTCCAGCTGCTCGGGAGG + Intronic
1033286158 7:140042353-140042375 TGGGCTTTCAGGTGGGCAGGTGG + Intronic
1033600979 7:142888284-142888306 GGTGCTTTCAGGAGCTTCTGGGG - Intergenic
1034369703 7:150584254-150584276 TGCGCTTCCAGGTGTTCCTGGGG - Intergenic
1035036416 7:155898035-155898057 TGTGCTTTCAGCTCCTCCTGGGG + Intergenic
1035189561 7:157153869-157153891 TGTGGTTTCAGTTACTCGGGAGG + Intronic
1035939171 8:3876729-3876751 TGTGCTTCCAGGTACTCAGGAGG - Intronic
1036214225 8:6865809-6865831 TGTGATTTCAGCTGCTTGGGAGG + Intergenic
1036631410 8:10518509-10518531 TGTGGTTCCAGCTACTCCGGAGG + Intergenic
1036837358 8:12084678-12084700 TGTAATTTCAGCTACTCCGGTGG + Intergenic
1036859151 8:12330922-12330944 TGTAATTTCAGCTACTCCGGTGG + Intergenic
1037318702 8:17623750-17623772 TGTGCTCCCAGCTGCTCAGGAGG + Intronic
1037807867 8:22068444-22068466 TGTAGTTTCAGCTGCTCAGGAGG + Intronic
1037851802 8:22336648-22336670 TGTAGTTACAGGTACTCCGGAGG + Intronic
1038764998 8:30419322-30419344 TGTAGTTTCAGCTGCTCAGGAGG + Intronic
1039797236 8:40925760-40925782 TGTGCTTTGAGGGGCTGCAGGGG + Intergenic
1041247776 8:55905288-55905310 TGTGATTCCAGCTACTCCGGAGG + Intronic
1042118872 8:65462188-65462210 TGTTCTTTTAGGTGCTCTAGGGG - Intergenic
1042794679 8:72648391-72648413 TGTGGTTTCAGCTACTCAGGCGG - Intronic
1043698336 8:83251054-83251076 TGTGCATGCAGGTGCACTGGTGG + Intergenic
1043994449 8:86795769-86795791 TGTGGTTTCAGCTACTCAGGAGG + Intergenic
1044719084 8:95128586-95128608 TGTGGTTCCAGCTACTCCGGAGG - Intergenic
1045460672 8:102422749-102422771 TGTGGTTCCAGCTGCTCAGGAGG + Intergenic
1046742319 8:117842818-117842840 TGTGCTCACAGGTCCTCCTGTGG + Intronic
1047738220 8:127785099-127785121 TGTGGTGTCAGGTACTCAGGAGG - Intergenic
1048342939 8:133554846-133554868 TGTAATTCCAGGTGCTCAGGAGG - Intronic
1048958612 8:139557246-139557268 TGTGCCTTTAGGTGCTCAAGAGG + Intergenic
1048996023 8:139794172-139794194 TCTGCTCTCAGGAGCTCCTGGGG - Intronic
1049105700 8:140611125-140611147 TGTGCTGACATTTGCTCCGGTGG + Intronic
1049638648 8:143704038-143704060 TGTAATTTCAGGTACTCGGGAGG - Intronic
1050948876 9:11562725-11562747 TGTGGTTCCAGCTGCTCGGGAGG - Intergenic
1051357701 9:16254863-16254885 TGTGCTTTCAGCTGCACCTGCGG + Intronic
1052566699 9:30162182-30162204 TGTGGTTTCAGCTACTCGGGAGG + Intergenic
1052844557 9:33323629-33323651 TGTGGTCCCAGCTGCTCCGGCGG + Intronic
1052910754 9:33879112-33879134 TGTGGTCTCAGCTGCTCAGGAGG + Intronic
1053355708 9:37443802-37443824 TGTGCCTTCAGCTACTCAGGAGG + Intronic
1056308564 9:85316896-85316918 TGTGTTCTCAGGTACTCTGGAGG - Intergenic
1056512925 9:87322588-87322610 TGTGGTTCCAGGTACTCAGGAGG - Intergenic
1057093495 9:92282646-92282668 TGTGGTCTCAGCTGCTCAGGAGG + Intronic
1057098793 9:92338188-92338210 TGTGCTCCCAGCTACTCCGGAGG + Intronic
1057213722 9:93216670-93216692 TGTGGTATCAGCTGCTCGGGAGG + Intronic
1058051816 9:100413795-100413817 TGTGGTCCCAGCTGCTCCGGCGG + Intergenic
1059407937 9:114113439-114113461 CGTGCTTCCCGCTGCTCCGGAGG - Intergenic
1060697426 9:125721293-125721315 TGTACTCTCAGCTGCTCAGGAGG + Intergenic
1060787325 9:126460784-126460806 TCTGCTGGCAGGTGCTCCTGGGG + Intronic
1060998539 9:127888682-127888704 TGTGATTCCAGCTGCTCGGGAGG + Intronic
1061159092 9:128882844-128882866 TGTGCATTCAGGTGGGCCCGAGG + Exonic
1061413763 9:130434511-130434533 TGTAGTTTCAGCTGCTCTGGAGG - Intergenic
1061437058 9:130570598-130570620 TGTGCTTCCAGCTACTCAGGAGG + Intergenic
1061575240 9:131502173-131502195 TGTGGTCTCAGCTGCTCTGGAGG + Intergenic
1061669591 9:132181203-132181225 TGTGATCCCAGGTGCTCAGGAGG - Intronic
1061984852 9:134124684-134124706 TGTGCTTCCAGCTACTCAGGAGG + Intergenic
1061993234 9:134171431-134171453 TGTAGTTTCAGCTACTCCGGAGG + Intergenic
1185818109 X:3175259-3175281 TGTCATTCCAGCTGCTCCGGTGG + Intergenic
1187919449 X:24186499-24186521 TGTGGTTCCAGCTGCTCAGGAGG + Intronic
1189289304 X:39873949-39873971 TGTGGTCTCAGGTACTCAGGAGG - Intergenic
1190212244 X:48458304-48458326 TGTGATTTCAAGTGATCCGCCGG + Intergenic
1191800452 X:65073415-65073437 TGTGGCTTCAGGTGCCCTGGGGG - Intergenic
1192444939 X:71203923-71203945 TGTGGTCTCAGGTACTCAGGAGG + Intergenic
1192513049 X:71737284-71737306 TGTGCTCCCAGGTACTCGGGAGG - Intergenic
1192513648 X:71744229-71744251 TGTGCTCCCAGGTACTCGGGAGG + Intergenic
1195712464 X:107784855-107784877 TGTGGTTTCAGCTACTCAGGAGG + Intronic
1197474650 X:126906125-126906147 TGTGGTCCCAGCTGCTCCGGAGG + Intergenic
1197741265 X:129896103-129896125 TGTGGTTCCAGGTACTCAGGAGG + Intergenic
1198541978 X:137649447-137649469 TGTGATTTCAGGTACTCGGGAGG + Intergenic
1198827520 X:140714698-140714720 TGTAATCTCAGCTGCTCCGGAGG + Intergenic
1202363908 Y:24141226-24141248 TTTGATGTCAGGTGCTCAGGAGG - Intergenic
1202506872 Y:25528896-25528918 TTTGATGTCAGGTGCTCAGGAGG + Intergenic