ID: 1128706736

View in Genome Browser
Species Human (GRCh38)
Location 15:69842343-69842365
Sequence GACCTGGCTTTCCCTGCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 255}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128706736_1128706740 -4 Left 1128706736 15:69842343-69842365 CCGGTGGCAGGGAAAGCCAGGTC 0: 1
1: 0
2: 0
3: 21
4: 255
Right 1128706740 15:69842362-69842384 GGTCTCCAGGCTCCTGGCCCAGG 0: 1
1: 0
2: 6
3: 75
4: 536
1128706736_1128706745 10 Left 1128706736 15:69842343-69842365 CCGGTGGCAGGGAAAGCCAGGTC 0: 1
1: 0
2: 0
3: 21
4: 255
Right 1128706745 15:69842376-69842398 TGGCCCAGGGCGTGTTTAGGAGG 0: 1
1: 0
2: 1
3: 6
4: 102
1128706736_1128706748 14 Left 1128706736 15:69842343-69842365 CCGGTGGCAGGGAAAGCCAGGTC 0: 1
1: 0
2: 0
3: 21
4: 255
Right 1128706748 15:69842380-69842402 CCAGGGCGTGTTTAGGAGGCAGG 0: 1
1: 0
2: 2
3: 8
4: 159
1128706736_1128706749 15 Left 1128706736 15:69842343-69842365 CCGGTGGCAGGGAAAGCCAGGTC 0: 1
1: 0
2: 0
3: 21
4: 255
Right 1128706749 15:69842381-69842403 CAGGGCGTGTTTAGGAGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 149
1128706736_1128706738 -10 Left 1128706736 15:69842343-69842365 CCGGTGGCAGGGAAAGCCAGGTC 0: 1
1: 0
2: 0
3: 21
4: 255
Right 1128706738 15:69842356-69842378 AAGCCAGGTCTCCAGGCTCCTGG 0: 1
1: 0
2: 9
3: 70
4: 469
1128706736_1128706743 7 Left 1128706736 15:69842343-69842365 CCGGTGGCAGGGAAAGCCAGGTC 0: 1
1: 0
2: 0
3: 21
4: 255
Right 1128706743 15:69842373-69842395 TCCTGGCCCAGGGCGTGTTTAGG 0: 1
1: 0
2: 0
3: 19
4: 150
1128706736_1128706741 -3 Left 1128706736 15:69842343-69842365 CCGGTGGCAGGGAAAGCCAGGTC 0: 1
1: 0
2: 0
3: 21
4: 255
Right 1128706741 15:69842363-69842385 GTCTCCAGGCTCCTGGCCCAGGG 0: 1
1: 0
2: 6
3: 62
4: 473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128706736 Original CRISPR GACCTGGCTTTCCCTGCCAC CGG (reversed) Intergenic
900886331 1:5418072-5418094 CTCCTGGATCTCCCTGCCACTGG - Intergenic
901211207 1:7527033-7527055 GACCTGACTCTTCCTGCCCCAGG + Intronic
901444827 1:9301749-9301771 GACCTGGCTATGGCTACCACTGG + Intronic
901652320 1:10750084-10750106 GGCCTGACTCTCCCTGCCCCCGG - Intronic
903240064 1:21976839-21976861 GACCTAGCGTTCCCTCCAACAGG - Intergenic
903243811 1:22001475-22001497 GACCTAGCGTTCCCTCCAACAGG - Intergenic
903373656 1:22852603-22852625 GGCCTGGCTCTCCCAGCCCCTGG - Intronic
904878994 1:33680369-33680391 GCTCCTGCTTTCCCTGCCACAGG + Intronic
906148076 1:43571665-43571687 GACACTGCTTTCCCTGCCTCCGG + Intronic
906205696 1:43985256-43985278 CACCTGCCTTCCCATGCCACAGG + Exonic
906831569 1:49037310-49037332 TAGCTGGCTTTCCTTCCCACAGG - Intronic
907813290 1:57893795-57893817 AGCCTGCCTTTCCCTGGCACTGG - Intronic
908079721 1:60563315-60563337 GACATTGCCTTCCCTGCCTCAGG + Intergenic
908649020 1:66311839-66311861 GCCCTGACTTTCTCTTCCACTGG - Intronic
910751591 1:90637045-90637067 GACCTTGTTTACACTGCCACAGG + Intergenic
912565653 1:110585515-110585537 GGCCTGGCTGGCCCTGTCACTGG - Intergenic
913422719 1:118690090-118690112 AGACTGCCTTTCCCTGCCACTGG + Intergenic
913450828 1:118991495-118991517 TACCTAGGTTTCCCTGCTACAGG + Intergenic
913531206 1:119735500-119735522 CGCCAGGCTTTCCCTGCCATGGG - Intronic
914097497 1:144556160-144556182 TACCTGGCTTTCCTTGGCAGAGG + Intergenic
914301497 1:146381458-146381480 TACCTGGCTTTCCTTGGCAGAGG - Intergenic
914444065 1:147734477-147734499 TACCTGGCTTTCCTTGGCAGAGG + Intergenic
915516967 1:156419195-156419217 CACCTGGCCTTCCCAGACACGGG - Intronic
916589191 1:166174024-166174046 GACCTGGGTTTCTCTGCAAGTGG - Intergenic
920126171 1:203695385-203695407 GCTCTGGCTTTCCCTCCTACTGG + Intronic
922773192 1:228200668-228200690 GATTTGGCTTTCTCTGGCACAGG + Intergenic
923724046 1:236491175-236491197 GGCCTTCCTCTCCCTGCCACGGG + Intergenic
1063786637 10:9392396-9392418 GGCCTGCCTTTCCCTGGCACTGG + Intergenic
1064149426 10:12850175-12850197 CACCTTGCTAACCCTGCCACAGG - Intergenic
1064928239 10:20593890-20593912 GGCCTGGCTCTCCCTGTCCCAGG - Intergenic
1065925950 10:30434011-30434033 GCTCTGGCTTACCCTGCAACCGG + Exonic
1067173651 10:43927260-43927282 GAGCTGGGTTTCTCTCCCACTGG + Intergenic
1068739781 10:60455995-60456017 GACCTGGCTTTCTCTGCCTAGGG - Intronic
1069363837 10:67675380-67675402 GACCTGGCTTAGCTTGCCCCAGG + Intronic
1069891333 10:71654302-71654324 TACGTGGCTTGCCCTGGCACAGG + Intronic
1069904153 10:71722630-71722652 GTCCTGGCCTTCCCTACCCCTGG - Intronic
1070435541 10:76388998-76389020 GACCTGCCTAACCCTGACACAGG + Intronic
1070891248 10:79943589-79943611 GGCCTGGCCTCCTCTGCCACGGG - Intronic
1073106710 10:101036464-101036486 GACCTGGCTTTTCCACCCACAGG + Exonic
1074484052 10:113855235-113855257 GACGGGGGTTTCCCTGGCACGGG + Intronic
1076128930 10:127998357-127998379 GACCAGGCTTTCACAGCGACTGG - Intronic
1077822678 11:5765191-5765213 GCACTGGCTCTCCCTGCCCCTGG + Intronic
1077918226 11:6624753-6624775 CACCTGGCTTCCCCTGCCGATGG - Exonic
1078891124 11:15560050-15560072 GGTCTGGATTTCCCTGTCACTGG - Intergenic
1079153904 11:17926386-17926408 TACCTGTCTCTCCCTGCCTCTGG - Intronic
1079769963 11:24446395-24446417 TACCTGGCTTTCCTAGGCACAGG - Intergenic
1080240409 11:30120991-30121013 GACCTTGCTTTACCAGCCAGTGG - Intergenic
1082789354 11:57336467-57336489 GACCTGGCTTCCGCAACCACAGG - Intergenic
1083679818 11:64346107-64346129 ACCCTGGCTTTCCCTGCCTGGGG - Intronic
1086203715 11:84233896-84233918 AAGCTGCCTTTCCCTGACACTGG - Intronic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1089322251 11:117634321-117634343 GGCCTGGCTGTCACTGTCACTGG + Intronic
1089619930 11:119716286-119716308 GGCCTGGCTTCCCCAGCCCCAGG + Intronic
1090472170 11:126990188-126990210 CACACGGGTTTCCCTGCCACAGG - Intronic
1091116424 11:133017913-133017935 GATCTGGCTTTCTGTGGCACGGG + Intronic
1091319624 11:134640493-134640515 GACCTGCCTTTCCCTTGAACTGG - Intergenic
1092423573 12:8355141-8355163 GACCTGGCTGGCTCTGCCATAGG + Intergenic
1092748715 12:11698136-11698158 TTCCTGTCCTTCCCTGCCACAGG + Intronic
1093092344 12:14936078-14936100 AAACTGGCTTTTCCTCCCACCGG + Intronic
1094233091 12:28130805-28130827 GTCCTGCCTTTGCCTCCCACTGG - Intergenic
1094414025 12:30199609-30199631 AACATGGCTTTGCCTGCCAGTGG - Intergenic
1096799205 12:54098263-54098285 GGCCTGGAGTTCCCTGCAACGGG - Intergenic
1098281683 12:68868504-68868526 GAACTGGATTTCCATGCCTCAGG - Intronic
1099970297 12:89493428-89493450 AACCTGGCTTACCCTTCCAGTGG + Intronic
1100889737 12:99111597-99111619 GACCTCGCTTTCCCACACACTGG - Intronic
1103741541 12:123094757-123094779 AACCTGGCCTTCCCTGCCCTCGG - Intronic
1103747104 12:123132373-123132395 GCCCTGGCTTTCCCAGACACTGG - Intronic
1103923312 12:124410668-124410690 GATCTGGCCCGCCCTGCCACCGG + Intronic
1103988947 12:124785406-124785428 GCCTTGCCTGTCCCTGCCACAGG + Intronic
1104755484 12:131266720-131266742 GACCAGGCTGTCCCTGCCGATGG + Intergenic
1106768668 13:32941019-32941041 GATCTTGCTTTGCCTGCCTCTGG + Intergenic
1107583014 13:41812406-41812428 GACCTGCCTTGCCCTCCCAAAGG - Intronic
1112579406 13:100665458-100665480 GCCCTGGCTTTCCAGGCCACAGG - Intronic
1114688055 14:24553870-24553892 GGCCTGGCTTGCTTTGCCACTGG - Intergenic
1118004323 14:61552274-61552296 GACCTGGCATCCCCTTCCAAGGG + Intronic
1118361770 14:65063046-65063068 CACTTGGCTTTCCCTTCCTCTGG + Intronic
1119206048 14:72794298-72794320 GAGCTGGCTTTTTCTGGCACTGG - Intronic
1120267921 14:82275028-82275050 AAACTGCCTTTCCCTGGCACTGG + Intergenic
1120906307 14:89624223-89624245 GTCCTGGCTGCCCCTGCAACAGG + Intergenic
1121410173 14:93744223-93744245 GACCACCCTTTCCCTGCCTCAGG + Intronic
1121818120 14:96943822-96943844 GCCCTGGCTGCCCCAGCCACTGG + Intergenic
1122571138 14:102702624-102702646 GCACTGCCTTTCCCTGCCTCTGG - Intronic
1202919358 14_KI270723v1_random:16634-16656 TACCTGGCTTTCCTAGGCACAGG + Intergenic
1202925274 14_KI270724v1_random:18360-18382 TACCTGGCTTTCCTAGGCACAGG - Intergenic
1123662778 15:22579362-22579384 GTCCTGGCTTTCAGTGCCAATGG + Intergenic
1124316579 15:28673666-28673688 GTCCTGGCTTTCAGTGCCAATGG + Intergenic
1124606372 15:31172785-31172807 GCCCTGGCTTTCCCACCCACAGG - Intergenic
1125507380 15:40274564-40274586 GTCCTGGCTTTCCCTGCTCATGG - Intronic
1125713295 15:41804454-41804476 AACCTGGCTTTCCCAGGCAGAGG - Intronic
1126653046 15:50945520-50945542 GACATGGATTACCCTCCCACTGG + Intronic
1127742188 15:61921170-61921192 GACCTGCCTTTCTCTGGCATAGG - Intronic
1128512411 15:68321503-68321525 CACCTGGCTCTCCCTGGCCCAGG - Exonic
1128537758 15:68503540-68503562 GACCTGGATTTTCCTCCCTCTGG + Intergenic
1128706736 15:69842343-69842365 GACCTGGCTTTCCCTGCCACCGG - Intergenic
1128993374 15:72278906-72278928 CACCCAGCTCTCCCTGCCACAGG + Intronic
1133721139 16:8495417-8495439 GTCCTGCATTTACCTGCCACTGG + Intergenic
1134256768 16:12618787-12618809 AGCCTGCCTTTCCCTGGCACTGG - Intergenic
1136127071 16:28191742-28191764 GAGCTGGCTTTACCTGGCATTGG + Intronic
1137616431 16:49850603-49850625 GACTTGGCTTTCCTGGCCACTGG - Intronic
1138050561 16:53772644-53772666 GACATGGATTTCCTTGGCACTGG + Intronic
1138232458 16:55348775-55348797 GACCTCCCTTTCCTTTCCACTGG - Intergenic
1138604940 16:58082601-58082623 GCCCTGCCTCTCCCTGCCTCAGG + Intergenic
1139192304 16:64878982-64879004 GACCTGCCTTTCTCAGGCACCGG + Intergenic
1139964955 16:70740293-70740315 TCCCTGACTTTGCCTGCCACGGG - Intronic
1141617996 16:85221055-85221077 GGCCTGGTTTTCCCAGCCGCAGG - Intergenic
1141698798 16:85633036-85633058 GACCTGGCCCTCCCGGCCAGTGG - Intronic
1141899081 16:86978663-86978685 GCCCGGGCTTTCCGTGCCTCGGG - Intergenic
1142438381 16:90077504-90077526 GGCCTGGCTTTTCCCGCCCCTGG + Intronic
1142640340 17:1281661-1281683 GTCCTGGCTTTACCTGCAAGCGG - Intronic
1142715475 17:1744970-1744992 GAGCTTTCTGTCCCTGCCACAGG + Exonic
1143574252 17:7780806-7780828 GACCTGACTTCCACTGTCACTGG + Intronic
1145989690 17:29071517-29071539 CACCTCTCTTTCCCTGCCCCAGG + Intergenic
1147498140 17:40937150-40937172 GAGCTGGCTTTCCCTTCTCCAGG - Intronic
1149588815 17:57812116-57812138 GCCCTGCCTTCCCCTGCCCCTGG + Intergenic
1151908598 17:77066384-77066406 GACCTGTGTGTCCCTTCCACGGG - Intergenic
1152942727 17:83181483-83181505 GGCCTGGCTTTCCATGCCTGGGG + Intergenic
1153569239 18:6451823-6451845 GGCCTGGCTAGACCTGCCACAGG + Intergenic
1153650795 18:7238082-7238104 CTCCTGGCTCTCTCTGCCACTGG + Intergenic
1159745765 18:72232772-72232794 AAACTGCCTTTCCCTGGCACGGG + Intergenic
1160133055 18:76246791-76246813 AATCTGGCTCTCCCAGCCACTGG + Intergenic
1160521686 18:79511673-79511695 GGCCTGGATTTCCCTCCCAGAGG + Intronic
1160593735 18:79960426-79960448 TACCTGGCTTTCCCAGGCAGAGG - Intergenic
1160659738 19:292313-292335 GGCCTGGGTTTCCCTGGCTCAGG - Intergenic
1160738853 19:676848-676870 ACCCTGGCTTTGCCTGCTACAGG - Intronic
1160939515 19:1613805-1613827 GAGCTGGCCTTCCCAGCCAGGGG - Intronic
1163173350 19:15548311-15548333 GGCCTGGCTATGCCTGCCCCAGG + Intronic
1164803679 19:31099274-31099296 GACTTGCCTTGCCATGCCACTGG + Intergenic
1165034475 19:33022858-33022880 GATCCGGCTTTCCATGCCCCCGG - Intronic
1165055586 19:33174358-33174380 GCCCTGGCTCTCCCAGCCCCTGG - Intronic
1165125622 19:33594593-33594615 GAATTGGCTTTGTCTGCCACAGG + Intergenic
1165606268 19:37107271-37107293 TACCTGGCTTTCCCAGGCAGAGG + Intronic
1166404738 19:42512075-42512097 GACCTTGCTTTCCCTGACTAGGG + Intronic
1167693751 19:51002304-51002326 GACCTGGTTTCCCCTTCCCCTGG + Intronic
925299219 2:2798516-2798538 CACCTGGCCATCCCAGCCACAGG + Intergenic
925885033 2:8388087-8388109 AGCCAAGCTTTCCCTGCCACAGG - Intergenic
926153181 2:10435736-10435758 GACCAGGCGTGCTCTGCCACTGG - Intergenic
927772724 2:25878087-25878109 GACCTCCCTTTCCCTGCGACTGG + Intronic
928274536 2:29887955-29887977 GACCTGACATTCTCTGCCAAAGG - Intronic
929544963 2:42849605-42849627 GAACTGTCCTTCCATGCCACTGG - Intergenic
931176355 2:59858803-59858825 GACCTGGCAGGCCCAGCCACCGG + Intergenic
932268743 2:70390506-70390528 GACCTGGCTTACCCCACCCCAGG + Intergenic
932294204 2:70610543-70610565 GGACTGGCTTTCCCTCCCTCAGG - Intronic
936036870 2:109120251-109120273 GGCCTGGCTTACCCTGCCAGGGG + Intergenic
936065319 2:109327295-109327317 GCCCAGCCTTTCCCTGCCGCTGG + Intronic
936456933 2:112682415-112682437 AACCTGGCTTTGCCTGACAGAGG + Intergenic
940857628 2:158741878-158741900 AGCCTGCCTTTCCCTGGCACTGG - Intergenic
941579017 2:167272149-167272171 GTCCTGGCATTTCCTGTCACAGG - Intergenic
942532362 2:176925122-176925144 GCCCTGGCTTTCCCTCACACCGG + Intergenic
946969950 2:225080429-225080451 GACCTTGCATTTCCTGCCACAGG + Intergenic
1169444080 20:5657069-5657091 TATCTGGCCTTCCCTTCCACAGG - Intergenic
1169459199 20:5779886-5779908 GACCTGGCTCCCCCAGCTACTGG + Intronic
1169763434 20:9121640-9121662 GACTTGTCTTTCCCTTTCACAGG - Intronic
1170622612 20:18008198-18008220 GACCAGACTGTCCCGGCCACAGG + Intronic
1171797217 20:29576083-29576105 GGCCTGGAGTTCCCTGCAACGGG + Intergenic
1171851035 20:30308078-30308100 GGCCTGGAGTTCCCTGCAACAGG - Intergenic
1175271786 20:57739169-57739191 GCATTGGCTTTGCCTGCCACTGG - Intergenic
1175365087 20:58447997-58448019 CTCGTGGCTTTCCCTGCCCCCGG + Exonic
1177177114 21:17712182-17712204 TGCCTGGCTTTCCCAGCCCCTGG - Intergenic
1179832351 21:44005190-44005212 GGACTGGCTTTCCCTGCACCCGG + Intergenic
1180101991 21:45592281-45592303 GCCCTGGTTTCCCCTTCCACAGG - Intergenic
1181133210 22:20746630-20746652 GACCTGGACGTCTCTGCCACTGG - Intronic
1181171279 22:21011615-21011637 TACCTGGCTTTGCATCCCACTGG - Intronic
1181582290 22:23835006-23835028 GACCTGGCTATGGGTGCCACTGG - Intronic
1181786275 22:25229594-25229616 GCCCTGGCTCACCCTGCCCCAGG + Intronic
1181818446 22:25457417-25457439 GCCCTGGCTCACCCTGCCCCAGG + Intergenic
1183058684 22:35322274-35322296 GCCCAGGCTCTCCCTGCCAGTGG - Intronic
1183293530 22:37017293-37017315 CACCTGGCCTTCCCTTCCACAGG + Intronic
1184341023 22:43885980-43886002 GACCTGGCTTTCGCAGGCACAGG + Intronic
1184417625 22:44361425-44361447 GACCTGGCTTCCCCTGAGAAGGG + Intergenic
1184654590 22:45934709-45934731 CACCTGGCTATGCCTGCCCCAGG + Intronic
1184700795 22:46171393-46171415 GACCTGTCTGTCCCTGCCAGAGG - Intronic
950030405 3:9848318-9848340 TACCTGGCTTTCCCAGGCAGAGG + Intronic
950414380 3:12860321-12860343 GACCTGGCATCCACTGGCACTGG + Intronic
950416747 3:12873192-12873214 GGCCTGGCTTTCACTGGCATCGG + Intergenic
953823921 3:46233690-46233712 GTCCTGGCTTTTCCTACCACGGG - Intronic
954444639 3:50540190-50540212 GGCCTGTCTTTACCTGCCCCAGG - Intergenic
954581272 3:51704127-51704149 GACCTGACTTCCCCTGCTCCAGG + Exonic
955869456 3:63421814-63421836 GCCCTGCCCTTCTCTGCCACAGG + Intronic
957082154 3:75645638-75645660 TACCTGGCTTTCCTAGGCACAGG - Intergenic
958958635 3:100488276-100488298 GTCCTGTCTGTCCATGCCACTGG + Intergenic
961713568 3:128844703-128844725 GGCCTGGCTTCCACTGGCACTGG - Intergenic
961820805 3:129574821-129574843 GATCTGGCTTTACCACCCACAGG - Intronic
961880392 3:130057596-130057618 TACCTGGCTTTCCCAGGCAGAGG - Intergenic
964249735 3:154699250-154699272 AAACTGCCTTTCCCTGGCACTGG - Intergenic
964719542 3:159757550-159757572 GACCTGGAACTCCCTGTCACCGG + Intronic
965971954 3:174570223-174570245 GACCAGGCTTGCCCTCCCATGGG - Intronic
968975876 4:3821801-3821823 GCCCTGCCTTTCCCTGCCCCAGG - Intergenic
968992782 4:3925950-3925972 TACCTGGCTTTCCCAGGCAGAGG - Intergenic
969376696 4:6768027-6768049 GACCTCCCTTTGCCTCCCACGGG + Intergenic
969418204 4:7074756-7074778 GTCCTGGCCTTCCCTGGCCCTGG - Intergenic
969725932 4:8918060-8918082 CGCCTGGGCTTCCCTGCCACAGG - Intergenic
969822693 4:9732411-9732433 TACCTGGCTTTCCCAGGCAGAGG + Intergenic
971010423 4:22428769-22428791 CATCTGGCTTTACGTGCCACAGG + Intronic
971371915 4:26026850-26026872 AACCTGTCTTTCACTGCCACAGG - Intergenic
971967400 4:33578079-33578101 AGCCTGCCTTTCCCTGGCACCGG + Intergenic
972340679 4:38149855-38149877 TATCTGTCTGTCCCTGCCACAGG + Intergenic
972459365 4:39286486-39286508 GACCTGTCCTTCCCTCCCAGTGG + Intergenic
974326647 4:60422922-60422944 AAACTGCCTTTCCCTGCAACTGG - Intergenic
974889364 4:67861197-67861219 AAACTGGCTTTCCCTGACATGGG + Intronic
979153461 4:117350808-117350830 AACCTGGATTTCCCTGGCTCAGG - Intergenic
979347990 4:119611750-119611772 GAACTCTCTTTCCCTACCACTGG - Intronic
984013598 4:174401070-174401092 TACCTGGCTTTCCTTGGCAGAGG - Intergenic
984257367 4:177404693-177404715 GACCAGGCTCTCACTGCTACAGG - Intergenic
985779715 5:1863999-1864021 AGCCTGGCTTTCCCTGGCCCCGG + Intergenic
988451972 5:31352471-31352493 GTCCTGGCTTCCTCTCCCACTGG + Intergenic
990381053 5:55222301-55222323 GCCCTGCCTCTCCCCGCCACTGG - Exonic
991657711 5:68920614-68920636 AAACTGCCTTTCCCTGGCACTGG + Intergenic
992476704 5:77109646-77109668 TACCTGGCTTTGCCAGCAACAGG - Intergenic
998108260 5:139482044-139482066 GACCTGGGTTCCCCTGTCCCCGG + Intronic
999257934 5:150220181-150220203 GAGCTTGGTTTCCCTGCCAGAGG - Intronic
999629312 5:153553794-153553816 AAACTGCCTTTCCCTGGCACTGG + Intronic
1002101283 5:176858982-176859004 GGGCTGGCTTTCTCTGCCTCTGG - Intronic
1002476472 5:179469210-179469232 AACGTGGCTTTCCCTACAACGGG - Intergenic
1002561434 5:180084812-180084834 GATGTGGCTTGCCCTGCCCCTGG + Intergenic
1003857641 6:10292506-10292528 GGCCTGATTTTTCCTGCCACTGG - Intergenic
1004460166 6:15828066-15828088 GGCCTCCCTTTCCCTGCCCCAGG - Intergenic
1005293417 6:24400688-24400710 TACCTGGCTTTCCCAGGCAGAGG + Intergenic
1006752607 6:36387956-36387978 GACCTGGCCTTGGCTCCCACTGG + Intergenic
1009269293 6:61598159-61598181 GACATGGCTACCACTGCCACTGG - Intergenic
1009683977 6:66932704-66932726 AGCCTGCCTTTCCCTGGCACTGG - Intergenic
1010454911 6:76043768-76043790 CACCAGGCATTCCCTGCCTCTGG - Intronic
1012375396 6:98555921-98555943 GTCCTTGCTTCCCCTGCCATAGG - Intergenic
1013359497 6:109381783-109381805 GAGCTGCCTCTCCCTGCCACTGG - Intronic
1013393678 6:109713215-109713237 CACCATGCTTTCGCTGCCACTGG - Intronic
1014102846 6:117530606-117530628 GACCTGGCTTCCCATTCCTCTGG - Intronic
1014555111 6:122836402-122836424 AAACTGCCTTTCCCTGGCACTGG - Intergenic
1018942442 6:168318738-168318760 GACTCTGATTTCCCTGCCACGGG - Intronic
1020315431 7:6902304-6902326 TACCTGGCTTTCCCAGGCAGAGG - Intergenic
1021747567 7:23757847-23757869 GACCTGGCTTTCCTAGGCAGAGG + Intronic
1022427224 7:30280828-30280850 GCCCTGGCTTTGTCTGACACTGG - Intergenic
1022482606 7:30753709-30753731 TACCAGTCTTTCCCTCCCACAGG + Exonic
1023731164 7:43193708-43193730 AGACTGCCTTTCCCTGCCACTGG + Intronic
1023739028 7:43261531-43261553 GACCTGGCTGCCCCTGGTACAGG + Intronic
1023813058 7:43926940-43926962 GAAAAGGCTTTCCCTGCAACGGG + Intronic
1026322519 7:69280006-69280028 AAACTGCCTTTCCCTGGCACTGG + Intergenic
1027420282 7:78011827-78011849 AGCCTGTCTTTCCCTGGCACCGG - Intergenic
1027687423 7:81294998-81295020 GCCCTGGCTGTCCATGCCATGGG + Intergenic
1028209631 7:88057743-88057765 GACCTAGCTTTCCATTCCAAGGG - Intronic
1033738451 7:144248614-144248636 TAACTGGCTTTCCCTGCTCCAGG - Intergenic
1033744600 7:144302340-144302362 TAACTGGCTTTCCCTGCTCCAGG + Intergenic
1035899820 8:3447713-3447735 GACCTGTCCATCCCTGCAACAGG - Intronic
1036441181 8:8782309-8782331 AGCCTGCCTTTCCCTGGCACCGG - Intergenic
1037813994 8:22102420-22102442 GACTGTGCTTTCCCTGGCACTGG - Intronic
1038148207 8:24917716-24917738 GACTTGCCTTTCTCTTCCACTGG - Exonic
1038148213 8:24917755-24917777 GACTTGCCTTTCTCTTCCACTGG - Exonic
1038148219 8:24917794-24917816 GACTTGCCTTTCTCTTCCACTGG - Exonic
1038148224 8:24917833-24917855 GACTTGCCTTTCTCTTCCACTGG - Exonic
1038148227 8:24917872-24917894 GATTTGGCTTTCTCTTCCACTGG - Exonic
1040545666 8:48396596-48396618 GCCCTGCCTTTCCCGGCCACAGG + Intergenic
1041015225 8:53586285-53586307 GAGCTGCCTTTCTCTCCCACGGG - Intergenic
1043143335 8:76618734-76618756 GACCTAGCAGTCCCTGCCATAGG + Intergenic
1045300763 8:100908290-100908312 GCCCTGGCTATCCGTGCCATGGG + Intergenic
1045605416 8:103768290-103768312 GACATCTCTTTCCCAGCCACTGG + Intronic
1045638709 8:104223468-104223490 GACGTGGCTTTCCTGGCCGCCGG - Intronic
1049095894 8:140547867-140547889 GGCCAGGCTTTCCCTCCCTCAGG + Intronic
1049488718 8:142879753-142879775 GCCCTGGCTGTCCCTGCAAAGGG - Exonic
1049493615 8:142917780-142917802 GCCCTGGCTGTCCCTGCAAAGGG - Exonic
1049608289 8:143540037-143540059 GACGTGGCTTTCTGTGCCCCCGG - Intronic
1053272340 9:36759073-36759095 AACCTGGCTCTCCTTGCCACAGG - Intergenic
1057195491 9:93113949-93113971 GCACTGGCTTTCCTTGCCCCTGG - Intergenic
1057333099 9:94134435-94134457 AAACTGTCTTTCCCTGGCACTGG - Intergenic
1059027308 9:110648923-110648945 CACCTGGCTTTGCCTGCAAGGGG + Intergenic
1061291457 9:129652644-129652666 CACCTGGCTTTACCTGCTCCCGG - Intergenic
1061438112 9:130579538-130579560 GTCCCGGCTTTCCCTTCCGCCGG + Intronic
1061747725 9:132752679-132752701 GGCCTGGCTGTCCCTGGCCCAGG + Intronic
1062024106 9:134332542-134332564 GACCTTGCTGTCCCTACCTCTGG - Intronic
1062318820 9:135980652-135980674 CACCTGGCTGTGCCGGCCACTGG + Intergenic
1062525267 9:136975721-136975743 GTCCTGGGTCTCCCTGCCCCGGG + Intergenic
1062599005 9:137311743-137311765 GACCTGGGCTCCCCAGCCACAGG + Intronic
1062653088 9:137588463-137588485 AACCTGGCTGTTGCTGCCACTGG - Intronic
1192504321 X:71671709-71671731 GCCCTGCCCTGCCCTGCCACAGG + Intergenic
1193287276 X:79727105-79727127 AGACTGGCTTTCCCTGGCACTGG - Intergenic
1194274731 X:91865544-91865566 GACCTGGCTGGCTTTGCCACTGG - Intronic
1195322052 X:103728353-103728375 GGCCTGTCTTTACCTGCCAGGGG + Exonic
1196585025 X:117419308-117419330 GACCTGGCTTGGCCTGGCAAGGG - Intergenic
1198957768 X:142150446-142150468 GGACTGCCTTTCCCTGGCACTGG - Intergenic
1199790598 X:151151958-151151980 GCCCGGGCTTGCCCTGCCACAGG + Intergenic