ID: 1128707130 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:69844488-69844510 |
Sequence | TGACTTCACTCTAGTGTAGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1128707128_1128707130 | 2 | Left | 1128707128 | 15:69844463-69844485 | CCTTATATGAACGTAGCTCAGGT | No data | ||
Right | 1128707130 | 15:69844488-69844510 | TGACTTCACTCTAGTGTAGAGGG | No data | ||||
1128707126_1128707130 | 9 | Left | 1128707126 | 15:69844456-69844478 | CCTAGATCCTTATATGAACGTAG | No data | ||
Right | 1128707130 | 15:69844488-69844510 | TGACTTCACTCTAGTGTAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1128707130 | Original CRISPR | TGACTTCACTCTAGTGTAGA GGG | Intergenic | ||