ID: 1128707130

View in Genome Browser
Species Human (GRCh38)
Location 15:69844488-69844510
Sequence TGACTTCACTCTAGTGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128707128_1128707130 2 Left 1128707128 15:69844463-69844485 CCTTATATGAACGTAGCTCAGGT No data
Right 1128707130 15:69844488-69844510 TGACTTCACTCTAGTGTAGAGGG No data
1128707126_1128707130 9 Left 1128707126 15:69844456-69844478 CCTAGATCCTTATATGAACGTAG No data
Right 1128707130 15:69844488-69844510 TGACTTCACTCTAGTGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128707130 Original CRISPR TGACTTCACTCTAGTGTAGA GGG Intergenic