ID: 1128707948

View in Genome Browser
Species Human (GRCh38)
Location 15:69851193-69851215
Sequence GCTCCCTCCCCAGTATCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128707948_1128707954 1 Left 1128707948 15:69851193-69851215 CCATTGGATACTGGGGAGGGAGC No data
Right 1128707954 15:69851217-69851239 GGGGGTAAATATGGACTCCCAGG No data
1128707948_1128707955 11 Left 1128707948 15:69851193-69851215 CCATTGGATACTGGGGAGGGAGC No data
Right 1128707955 15:69851227-69851249 ATGGACTCCCAGGATTGTCTTGG No data
1128707948_1128707953 -8 Left 1128707948 15:69851193-69851215 CCATTGGATACTGGGGAGGGAGC No data
Right 1128707953 15:69851208-69851230 GAGGGAGCTGGGGGTAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128707948 Original CRISPR GCTCCCTCCCCAGTATCCAA TGG (reversed) Intergenic
No off target data available for this crispr