ID: 1128710758

View in Genome Browser
Species Human (GRCh38)
Location 15:69869733-69869755
Sequence TGGGGCCATCAGCAGAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128710751_1128710758 5 Left 1128710751 15:69869705-69869727 CCTCCTGTTTCAGTAGCTCTGCT No data
Right 1128710758 15:69869733-69869755 TGGGGCCATCAGCAGAAACTGGG No data
1128710747_1128710758 23 Left 1128710747 15:69869687-69869709 CCTGGGTCAGATGCCCACCCTCC No data
Right 1128710758 15:69869733-69869755 TGGGGCCATCAGCAGAAACTGGG No data
1128710746_1128710758 28 Left 1128710746 15:69869682-69869704 CCAAGCCTGGGTCAGATGCCCAC No data
Right 1128710758 15:69869733-69869755 TGGGGCCATCAGCAGAAACTGGG No data
1128710749_1128710758 9 Left 1128710749 15:69869701-69869723 CCACCCTCCTGTTTCAGTAGCTC No data
Right 1128710758 15:69869733-69869755 TGGGGCCATCAGCAGAAACTGGG No data
1128710748_1128710758 10 Left 1128710748 15:69869700-69869722 CCCACCCTCCTGTTTCAGTAGCT No data
Right 1128710758 15:69869733-69869755 TGGGGCCATCAGCAGAAACTGGG No data
1128710752_1128710758 2 Left 1128710752 15:69869708-69869730 CCTGTTTCAGTAGCTCTGCTTCA No data
Right 1128710758 15:69869733-69869755 TGGGGCCATCAGCAGAAACTGGG No data
1128710750_1128710758 6 Left 1128710750 15:69869704-69869726 CCCTCCTGTTTCAGTAGCTCTGC No data
Right 1128710758 15:69869733-69869755 TGGGGCCATCAGCAGAAACTGGG No data
1128710745_1128710758 29 Left 1128710745 15:69869681-69869703 CCCAAGCCTGGGTCAGATGCCCA No data
Right 1128710758 15:69869733-69869755 TGGGGCCATCAGCAGAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128710758 Original CRISPR TGGGGCCATCAGCAGAAACT GGG Intergenic
No off target data available for this crispr