ID: 1128713276

View in Genome Browser
Species Human (GRCh38)
Location 15:69887897-69887919
Sequence CAGGAGAAAAGGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128713268_1128713276 -4 Left 1128713268 15:69887878-69887900 CCCCAGGCAGAGGGACCAGCAGG No data
Right 1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG No data
1128713271_1128713276 -6 Left 1128713271 15:69887880-69887902 CCAGGCAGAGGGACCAGCAGGAG No data
Right 1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG No data
1128713270_1128713276 -5 Left 1128713270 15:69887879-69887901 CCCAGGCAGAGGGACCAGCAGGA No data
Right 1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128713276 Original CRISPR CAGGAGAAAAGGAAGGAGGA AGG Intergenic
No off target data available for this crispr