ID: 1128713771

View in Genome Browser
Species Human (GRCh38)
Location 15:69892058-69892080
Sequence CCCTCCAACCATGATTTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128713771_1128713774 5 Left 1128713771 15:69892058-69892080 CCAAATAAATCATGGTTGGAGGG No data
Right 1128713774 15:69892086-69892108 TTTGTATTTTTAAAGCGAAATGG No data
1128713771_1128713776 25 Left 1128713771 15:69892058-69892080 CCAAATAAATCATGGTTGGAGGG No data
Right 1128713776 15:69892106-69892128 TGGAAGAGTAATGGAATGCGAGG No data
1128713771_1128713775 16 Left 1128713771 15:69892058-69892080 CCAAATAAATCATGGTTGGAGGG No data
Right 1128713775 15:69892097-69892119 AAAGCGAAATGGAAGAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128713771 Original CRISPR CCCTCCAACCATGATTTATT TGG (reversed) Intergenic
No off target data available for this crispr