ID: 1128713775

View in Genome Browser
Species Human (GRCh38)
Location 15:69892097-69892119
Sequence AAAGCGAAATGGAAGAGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128713771_1128713775 16 Left 1128713771 15:69892058-69892080 CCAAATAAATCATGGTTGGAGGG No data
Right 1128713775 15:69892097-69892119 AAAGCGAAATGGAAGAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128713775 Original CRISPR AAAGCGAAATGGAAGAGTAA TGG Intergenic
No off target data available for this crispr