ID: 1128713776

View in Genome Browser
Species Human (GRCh38)
Location 15:69892106-69892128
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128713771_1128713776 25 Left 1128713771 15:69892058-69892080 CCAAATAAATCATGGTTGGAGGG No data
Right 1128713776 15:69892106-69892128 TGGAAGAGTAATGGAATGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128713776 Original CRISPR TGGAAGAGTAATGGAATGCG AGG Intergenic
No off target data available for this crispr