ID: 1128716597

View in Genome Browser
Species Human (GRCh38)
Location 15:69913257-69913279
Sequence GCAGATAAGCAGCCCTTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128716597_1128716599 -3 Left 1128716597 15:69913257-69913279 CCATGCAAGGGCTGCTTATCTGC No data
Right 1128716599 15:69913277-69913299 TGCCAGGAGAAGACTCTTGATGG No data
1128716597_1128716601 1 Left 1128716597 15:69913257-69913279 CCATGCAAGGGCTGCTTATCTGC No data
Right 1128716601 15:69913281-69913303 AGGAGAAGACTCTTGATGGCTGG No data
1128716597_1128716603 14 Left 1128716597 15:69913257-69913279 CCATGCAAGGGCTGCTTATCTGC No data
Right 1128716603 15:69913294-69913316 TGATGGCTGGAGAACACAGTGGG No data
1128716597_1128716602 13 Left 1128716597 15:69913257-69913279 CCATGCAAGGGCTGCTTATCTGC No data
Right 1128716602 15:69913293-69913315 TTGATGGCTGGAGAACACAGTGG No data
1128716597_1128716604 21 Left 1128716597 15:69913257-69913279 CCATGCAAGGGCTGCTTATCTGC No data
Right 1128716604 15:69913301-69913323 TGGAGAACACAGTGGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128716597 Original CRISPR GCAGATAAGCAGCCCTTGCA TGG (reversed) Intergenic
No off target data available for this crispr