ID: 1128721889

View in Genome Browser
Species Human (GRCh38)
Location 15:69956133-69956155
Sequence CTTGATGCCCACAGTGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128721889_1128721893 30 Left 1128721889 15:69956133-69956155 CCTTGCACACTGTGGGCATCAAG No data
Right 1128721893 15:69956186-69956208 AAAAAAACAACACTGTATTGGGG No data
1128721889_1128721891 28 Left 1128721889 15:69956133-69956155 CCTTGCACACTGTGGGCATCAAG No data
Right 1128721891 15:69956184-69956206 AAAAAAAAACAACACTGTATTGG No data
1128721889_1128721892 29 Left 1128721889 15:69956133-69956155 CCTTGCACACTGTGGGCATCAAG No data
Right 1128721892 15:69956185-69956207 AAAAAAAACAACACTGTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128721889 Original CRISPR CTTGATGCCCACAGTGTGCA AGG (reversed) Intergenic
No off target data available for this crispr