ID: 1128723685

View in Genome Browser
Species Human (GRCh38)
Location 15:69972119-69972141
Sequence CTGGCCTGCTTGGTCAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128723678_1128723685 1 Left 1128723678 15:69972095-69972117 CCAGAGCCACCTGAGAAATCCTG No data
Right 1128723685 15:69972119-69972141 CTGGCCTGCTTGGTCAAAACAGG No data
1128723680_1128723685 -5 Left 1128723680 15:69972101-69972123 CCACCTGAGAAATCCTGCCTGGC No data
Right 1128723685 15:69972119-69972141 CTGGCCTGCTTGGTCAAAACAGG No data
1128723677_1128723685 20 Left 1128723677 15:69972076-69972098 CCAAGGAGTCTGAGGCTTTCCAG No data
Right 1128723685 15:69972119-69972141 CTGGCCTGCTTGGTCAAAACAGG No data
1128723681_1128723685 -8 Left 1128723681 15:69972104-69972126 CCTGAGAAATCCTGCCTGGCCTG No data
Right 1128723685 15:69972119-69972141 CTGGCCTGCTTGGTCAAAACAGG No data
1128723675_1128723685 28 Left 1128723675 15:69972068-69972090 CCTTGGATCCAAGGAGTCTGAGG No data
Right 1128723685 15:69972119-69972141 CTGGCCTGCTTGGTCAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128723685 Original CRISPR CTGGCCTGCTTGGTCAAAAC AGG Intergenic
No off target data available for this crispr