ID: 1128723959

View in Genome Browser
Species Human (GRCh38)
Location 15:69974258-69974280
Sequence GCCCTGGGTCGGGGGGTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128723959_1128723968 -9 Left 1128723959 15:69974258-69974280 CCCATGACCCCCCGACCCAGGGC No data
Right 1128723968 15:69974272-69974294 ACCCAGGGCAGCAGGGACAGAGG No data
1128723959_1128723971 -2 Left 1128723959 15:69974258-69974280 CCCATGACCCCCCGACCCAGGGC No data
Right 1128723971 15:69974279-69974301 GCAGCAGGGACAGAGGTGAAAGG No data
1128723959_1128723972 18 Left 1128723959 15:69974258-69974280 CCCATGACCCCCCGACCCAGGGC No data
Right 1128723972 15:69974299-69974321 AGGCTGTCCAAAGAAGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128723959 Original CRISPR GCCCTGGGTCGGGGGGTCAT GGG (reversed) Intergenic