ID: 1128724141

View in Genome Browser
Species Human (GRCh38)
Location 15:69975389-69975411
Sequence GCCCCTGCCCTGTCCATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128724132_1128724141 8 Left 1128724132 15:69975358-69975380 CCTAGGATGCAGTCAGCCCTGGG No data
Right 1128724141 15:69975389-69975411 GCCCCTGCCCTGTCCATGGGTGG No data
1128724128_1128724141 25 Left 1128724128 15:69975341-69975363 CCTGGAGGCATCCAAGGCCTAGG No data
Right 1128724141 15:69975389-69975411 GCCCCTGCCCTGTCCATGGGTGG No data
1128724136_1128724141 -9 Left 1128724136 15:69975375-69975397 CCTGGGGCCCTGATGCCCCTGCC No data
Right 1128724141 15:69975389-69975411 GCCCCTGCCCTGTCCATGGGTGG No data
1128724130_1128724141 14 Left 1128724130 15:69975352-69975374 CCAAGGCCTAGGATGCAGTCAGC No data
Right 1128724141 15:69975389-69975411 GCCCCTGCCCTGTCCATGGGTGG No data
1128724135_1128724141 -8 Left 1128724135 15:69975374-69975396 CCCTGGGGCCCTGATGCCCCTGC No data
Right 1128724141 15:69975389-69975411 GCCCCTGCCCTGTCCATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128724141 Original CRISPR GCCCCTGCCCTGTCCATGGG TGG Intergenic
No off target data available for this crispr