ID: 1128724449

View in Genome Browser
Species Human (GRCh38)
Location 15:69977652-69977674
Sequence ATGGAGAAAGGAGCTGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128724444_1128724449 9 Left 1128724444 15:69977620-69977642 CCCTTTTTGACAGTGTTTGTTGT No data
Right 1128724449 15:69977652-69977674 ATGGAGAAAGGAGCTGAGGTTGG No data
1128724443_1128724449 28 Left 1128724443 15:69977601-69977623 CCTTTAACACTCACAACATCCCT No data
Right 1128724449 15:69977652-69977674 ATGGAGAAAGGAGCTGAGGTTGG No data
1128724445_1128724449 8 Left 1128724445 15:69977621-69977643 CCTTTTTGACAGTGTTTGTTGTC No data
Right 1128724449 15:69977652-69977674 ATGGAGAAAGGAGCTGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128724449 Original CRISPR ATGGAGAAAGGAGCTGAGGT TGG Intergenic
No off target data available for this crispr