ID: 1128724739

View in Genome Browser
Species Human (GRCh38)
Location 15:69980049-69980071
Sequence TCCAGGACGCAGGTTTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128724733_1128724739 11 Left 1128724733 15:69980015-69980037 CCGGCGCACAGTCATACTTGAGA No data
Right 1128724739 15:69980049-69980071 TCCAGGACGCAGGTTTCCCCTGG No data
1128724732_1128724739 21 Left 1128724732 15:69980005-69980027 CCAGGTGTTTCCGGCGCACAGTC No data
Right 1128724739 15:69980049-69980071 TCCAGGACGCAGGTTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128724739 Original CRISPR TCCAGGACGCAGGTTTCCCC TGG Intergenic
No off target data available for this crispr