ID: 1128726229

View in Genome Browser
Species Human (GRCh38)
Location 15:69990577-69990599
Sequence CTAACACACGGTGCAGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128726229_1128726234 7 Left 1128726229 15:69990577-69990599 CCAGAATCTGCACCGTGTGTTAG No data
Right 1128726234 15:69990607-69990629 CCTTCTACTGCCTGTGCATGAGG No data
1128726229_1128726239 23 Left 1128726229 15:69990577-69990599 CCAGAATCTGCACCGTGTGTTAG No data
Right 1128726239 15:69990623-69990645 CATGAGGAGCTGGGATGGCCAGG No data
1128726229_1128726241 27 Left 1128726229 15:69990577-69990599 CCAGAATCTGCACCGTGTGTTAG No data
Right 1128726241 15:69990627-69990649 AGGAGCTGGGATGGCCAGGGCGG No data
1128726229_1128726242 28 Left 1128726229 15:69990577-69990599 CCAGAATCTGCACCGTGTGTTAG No data
Right 1128726242 15:69990628-69990650 GGAGCTGGGATGGCCAGGGCGGG No data
1128726229_1128726235 13 Left 1128726229 15:69990577-69990599 CCAGAATCTGCACCGTGTGTTAG No data
Right 1128726235 15:69990613-69990635 ACTGCCTGTGCATGAGGAGCTGG No data
1128726229_1128726238 18 Left 1128726229 15:69990577-69990599 CCAGAATCTGCACCGTGTGTTAG No data
Right 1128726238 15:69990618-69990640 CTGTGCATGAGGAGCTGGGATGG No data
1128726229_1128726240 24 Left 1128726229 15:69990577-69990599 CCAGAATCTGCACCGTGTGTTAG No data
Right 1128726240 15:69990624-69990646 ATGAGGAGCTGGGATGGCCAGGG No data
1128726229_1128726236 14 Left 1128726229 15:69990577-69990599 CCAGAATCTGCACCGTGTGTTAG No data
Right 1128726236 15:69990614-69990636 CTGCCTGTGCATGAGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128726229 Original CRISPR CTAACACACGGTGCAGATTC TGG (reversed) Intergenic
No off target data available for this crispr