ID: 1128726231

View in Genome Browser
Species Human (GRCh38)
Location 15:69990589-69990611
Sequence GAAGGCACCTGGCTAACACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128726231_1128726235 1 Left 1128726231 15:69990589-69990611 CCGTGTGTTAGCCAGGTGCCTTC No data
Right 1128726235 15:69990613-69990635 ACTGCCTGTGCATGAGGAGCTGG No data
1128726231_1128726243 25 Left 1128726231 15:69990589-69990611 CCGTGTGTTAGCCAGGTGCCTTC No data
Right 1128726243 15:69990637-69990659 ATGGCCAGGGCGGGAGACTGTGG No data
1128726231_1128726239 11 Left 1128726231 15:69990589-69990611 CCGTGTGTTAGCCAGGTGCCTTC No data
Right 1128726239 15:69990623-69990645 CATGAGGAGCTGGGATGGCCAGG No data
1128726231_1128726240 12 Left 1128726231 15:69990589-69990611 CCGTGTGTTAGCCAGGTGCCTTC No data
Right 1128726240 15:69990624-69990646 ATGAGGAGCTGGGATGGCCAGGG No data
1128726231_1128726236 2 Left 1128726231 15:69990589-69990611 CCGTGTGTTAGCCAGGTGCCTTC No data
Right 1128726236 15:69990614-69990636 CTGCCTGTGCATGAGGAGCTGGG No data
1128726231_1128726238 6 Left 1128726231 15:69990589-69990611 CCGTGTGTTAGCCAGGTGCCTTC No data
Right 1128726238 15:69990618-69990640 CTGTGCATGAGGAGCTGGGATGG No data
1128726231_1128726234 -5 Left 1128726231 15:69990589-69990611 CCGTGTGTTAGCCAGGTGCCTTC No data
Right 1128726234 15:69990607-69990629 CCTTCTACTGCCTGTGCATGAGG No data
1128726231_1128726241 15 Left 1128726231 15:69990589-69990611 CCGTGTGTTAGCCAGGTGCCTTC No data
Right 1128726241 15:69990627-69990649 AGGAGCTGGGATGGCCAGGGCGG No data
1128726231_1128726242 16 Left 1128726231 15:69990589-69990611 CCGTGTGTTAGCCAGGTGCCTTC No data
Right 1128726242 15:69990628-69990650 GGAGCTGGGATGGCCAGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128726231 Original CRISPR GAAGGCACCTGGCTAACACA CGG (reversed) Intergenic
No off target data available for this crispr