ID: 1128726238

View in Genome Browser
Species Human (GRCh38)
Location 15:69990618-69990640
Sequence CTGTGCATGAGGAGCTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128726231_1128726238 6 Left 1128726231 15:69990589-69990611 CCGTGTGTTAGCCAGGTGCCTTC No data
Right 1128726238 15:69990618-69990640 CTGTGCATGAGGAGCTGGGATGG No data
1128726229_1128726238 18 Left 1128726229 15:69990577-69990599 CCAGAATCTGCACCGTGTGTTAG No data
Right 1128726238 15:69990618-69990640 CTGTGCATGAGGAGCTGGGATGG No data
1128726232_1128726238 -5 Left 1128726232 15:69990600-69990622 CCAGGTGCCTTCTACTGCCTGTG No data
Right 1128726238 15:69990618-69990640 CTGTGCATGAGGAGCTGGGATGG No data
1128726228_1128726238 19 Left 1128726228 15:69990576-69990598 CCCAGAATCTGCACCGTGTGTTA No data
Right 1128726238 15:69990618-69990640 CTGTGCATGAGGAGCTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128726238 Original CRISPR CTGTGCATGAGGAGCTGGGA TGG Intergenic
No off target data available for this crispr