ID: 1128728108

View in Genome Browser
Species Human (GRCh38)
Location 15:70002637-70002659
Sequence TCCAGGGAGCTCAGGGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128728100_1128728108 -7 Left 1128728100 15:70002621-70002643 CCCAGACCACTGCCTGTCCAGGG No data
Right 1128728108 15:70002637-70002659 TCCAGGGAGCTCAGGGCAAAGGG No data
1128728102_1128728108 -8 Left 1128728102 15:70002622-70002644 CCAGACCACTGCCTGTCCAGGGA No data
Right 1128728108 15:70002637-70002659 TCCAGGGAGCTCAGGGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128728108 Original CRISPR TCCAGGGAGCTCAGGGCAAA GGG Intergenic
No off target data available for this crispr