ID: 1128731792

View in Genome Browser
Species Human (GRCh38)
Location 15:70026310-70026332
Sequence TGCTGTGTAGGGAAAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128731788_1128731792 3 Left 1128731788 15:70026284-70026306 CCTGCAGGCTCAGACAGGATGCT No data
Right 1128731792 15:70026310-70026332 TGCTGTGTAGGGAAAGCAGAAGG No data
1128731786_1128731792 5 Left 1128731786 15:70026282-70026304 CCCCTGCAGGCTCAGACAGGATG No data
Right 1128731792 15:70026310-70026332 TGCTGTGTAGGGAAAGCAGAAGG No data
1128731787_1128731792 4 Left 1128731787 15:70026283-70026305 CCCTGCAGGCTCAGACAGGATGC No data
Right 1128731792 15:70026310-70026332 TGCTGTGTAGGGAAAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128731792 Original CRISPR TGCTGTGTAGGGAAAGCAGA AGG Intergenic
No off target data available for this crispr