ID: 1128732983

View in Genome Browser
Species Human (GRCh38)
Location 15:70033635-70033657
Sequence GCCCAGCGCCCCAGGCGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128732969_1128732983 22 Left 1128732969 15:70033590-70033612 CCTCCATGCTGGGGGAAGGGAGC No data
Right 1128732983 15:70033635-70033657 GCCCAGCGCCCCAGGCGCGGGGG No data
1128732974_1128732983 0 Left 1128732974 15:70033612-70033634 CCCAGGGCAGTGGCAAAGCCCAG No data
Right 1128732983 15:70033635-70033657 GCCCAGCGCCCCAGGCGCGGGGG No data
1128732970_1128732983 19 Left 1128732970 15:70033593-70033615 CCATGCTGGGGGAAGGGAGCCCA No data
Right 1128732983 15:70033635-70033657 GCCCAGCGCCCCAGGCGCGGGGG No data
1128732967_1128732983 25 Left 1128732967 15:70033587-70033609 CCGCCTCCATGCTGGGGGAAGGG No data
Right 1128732983 15:70033635-70033657 GCCCAGCGCCCCAGGCGCGGGGG No data
1128732975_1128732983 -1 Left 1128732975 15:70033613-70033635 CCAGGGCAGTGGCAAAGCCCAGG No data
Right 1128732983 15:70033635-70033657 GCCCAGCGCCCCAGGCGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128732983 Original CRISPR GCCCAGCGCCCCAGGCGCGG GGG Intergenic
No off target data available for this crispr