ID: 1128735493

View in Genome Browser
Species Human (GRCh38)
Location 15:70051519-70051541
Sequence AGCAAGACCTGCCCTAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128735489_1128735493 29 Left 1128735489 15:70051467-70051489 CCTGCAGGTGGGAGGCAAAGGCA 0: 1
1: 0
2: 11
3: 285
4: 1377
Right 1128735493 15:70051519-70051541 AGCAAGACCTGCCCTAGACATGG 0: 1
1: 0
2: 4
3: 15
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128735493 Original CRISPR AGCAAGACCTGCCCTAGACA TGG Intronic
901170856 1:7256262-7256284 AGCAAGAGCAGCCCTAGGCCGGG + Intronic
902706625 1:18209840-18209862 AGACAAACCTGCCCCAGACACGG + Intronic
904032638 1:27542837-27542859 AACAAGGCCTGGCCTAAACATGG + Intronic
906078657 1:43069469-43069491 ACCAAGATTTGACCTAGACAGGG + Intergenic
906748348 1:48237283-48237305 GGAAAGAGCTGCCCTACACAGGG + Intronic
908399108 1:63753672-63753694 AGAAAGAACTGCCCGAGACTGGG + Intergenic
908476224 1:64491434-64491456 AGCAAGGCATGCCTTATACATGG + Intronic
909820914 1:80059790-80059812 ATAAAGAACTGCCCTAGACTGGG + Intergenic
910968463 1:92831093-92831115 AGCAGGGCCTGACCAAGACATGG + Intergenic
912530280 1:110315862-110315884 AGCAAGAACTGCCCTAGACTGGG + Intergenic
915431677 1:155871692-155871714 AGCAACACATGCCCTGGAGAAGG + Intronic
915567098 1:156721196-156721218 AGCCAGACCAGACCCAGACATGG - Intergenic
915873940 1:159592125-159592147 ATAAAGACCTGCCCAAGACAGGG - Intergenic
916076180 1:161201155-161201177 ACCAGGACCTGGGCTAGACAAGG - Intronic
916409662 1:164533486-164533508 ATCAAGACCTGCCTTAGAGAAGG - Intergenic
921546692 1:216482394-216482416 AGCAAGAACTGTCCCAGCCAGGG + Intergenic
923397284 1:233579574-233579596 ATAAAGAACTGCCCTAGACTGGG + Intergenic
1066552523 10:36574981-36575003 AGAAAGAACTGCCCAAGACCAGG - Intergenic
1067121331 10:43474553-43474575 AGCAAGACCTGGCCTCTAAAAGG + Intronic
1067263790 10:44719143-44719165 CCCAAGACCTGCCCTAGAAAAGG - Intergenic
1072901387 10:99410334-99410356 AGCAAGACCTCCCTTGAACATGG + Intronic
1074689592 10:115992235-115992257 AGAAAGAACTGCCCAAGACTGGG - Intergenic
1074736815 10:116443941-116443963 ATAAAGAACTGCCCTAGACTGGG + Intronic
1076482755 10:130795653-130795675 GGCAGGTGCTGCCCTAGACACGG - Intergenic
1078865733 11:15295683-15295705 AGCCAGCCCAGCCTTAGACAGGG + Intergenic
1078870615 11:15340959-15340981 AGAAAGACCTGCCCAATAAAAGG - Intergenic
1080084437 11:28260990-28261012 AGGAAGACCTGCTGTAGATATGG + Intronic
1080541763 11:33272857-33272879 AGCAAGACCTCATCTCGACAGGG - Intronic
1081567416 11:44268649-44268671 AGCAAGAGCTGCCCTACCCCTGG + Intronic
1081638127 11:44734517-44734539 AGGAAGAGCTGCCCTTGGCAAGG + Intronic
1082093344 11:48107321-48107343 TGCTAGAACTGCCCTAGAGATGG - Intronic
1087400542 11:97659923-97659945 ATAAAGAACTGCCCTAGACTGGG - Intergenic
1089039877 11:115437200-115437222 TGCAAGACCTGCCCCAGAGGTGG + Intronic
1090156232 11:124441262-124441284 AGCAGCACCTGCCCTGGCCATGG - Intergenic
1093931089 12:24955693-24955715 AGAAAGACATGCCCAAGACTGGG - Intergenic
1094593599 12:31843982-31844004 ATGAAGAACTGCCCTAGACTGGG - Intergenic
1095216541 12:39556613-39556635 ATAAAGAACTGCCCTAGACCGGG - Intronic
1095350452 12:41204497-41204519 ATAAAGAACTGCCCTAGACTGGG + Intronic
1095615523 12:44183880-44183902 AGCAAGACCTTCCCAAGCCAAGG + Intronic
1095943618 12:47741258-47741280 AGGAGGACCTGCCCTAGTTAGGG - Intronic
1096369736 12:51058978-51059000 ATCAAGACCTAGCCTAAACAGGG - Intronic
1101843378 12:108343115-108343137 AGCAATGCCTGCCCTGGACCTGG + Intergenic
1104611236 12:130229455-130229477 ATAAAGAACTGCCCTAGACTGGG + Intergenic
1110543504 13:76731235-76731257 AGAAAGACATACCCTAGACTGGG - Intergenic
1110766206 13:79281948-79281970 AGCATGACATGACATAGACAAGG - Intergenic
1111064753 13:83075199-83075221 AGAAAGACCTGCCATACAAAGGG + Intergenic
1111909400 13:94293537-94293559 ATCAAGAACTGCCCAAGACTGGG - Intronic
1112142817 13:96664735-96664757 AGTAAGAACTGCCCAAGAAAAGG - Intronic
1113946271 13:114045483-114045505 AGCAAGAGCTGCCCGAGACAGGG + Intronic
1114454970 14:22848407-22848429 AGAAACTCCTGCCCCAGACAGGG + Intronic
1114977568 14:28121347-28121369 AGCAAAAACTGCCCTCCACAAGG + Intergenic
1115179350 14:30604302-30604324 AGCAAAACCTGGCCTACACTAGG + Intronic
1116132883 14:40881226-40881248 ACCAAGCCATGACCTAGACAAGG - Intergenic
1116641757 14:47472624-47472646 AGCCAGCCATGTCCTAGACATGG + Intronic
1117103780 14:52378327-52378349 AGCAAGCCCTGCCCGAGGAAGGG - Intergenic
1117316974 14:54580649-54580671 AGGAAGAGCTGTCGTAGACAAGG - Intronic
1118150005 14:63179252-63179274 AGGAAGACCTGCCCTCAACGCGG + Intergenic
1118877447 14:69797202-69797224 AGCAAGAACTGCACAAGAAACGG - Exonic
1120341813 14:83229849-83229871 AGCAAAACCTGCCCTATTCTTGG + Intergenic
1121152852 14:91653462-91653484 ATCAAGACATGCCCGAGACTGGG + Intronic
1121783857 14:96639993-96640015 AGCATGCCATGTCCTAGACAGGG - Intergenic
1121889785 14:97578821-97578843 AGCTAGACCTTCTCTAGCCAAGG + Intergenic
1122425109 14:101601283-101601305 AGGAAGACATGCTCTAGGCAGGG - Intergenic
1122551609 14:102553027-102553049 AGCAAGACTTGCTCTGGGCAAGG - Intergenic
1127315719 15:57792042-57792064 AGCAGGACCTTCCTTAGACCTGG - Intergenic
1127839351 15:62817560-62817582 ACCATGACCAGCCCTAGACACGG - Intronic
1128577994 15:68789427-68789449 AGCAGGAGCAGCCCTGGACAGGG - Intronic
1128735493 15:70051519-70051541 AGCAAGACCTGCCCTAGACATGG + Intronic
1130256673 15:82329072-82329094 AGCAAGACCTCAGCAAGACAGGG - Intergenic
1130598277 15:85260916-85260938 AGCAAGACCTCAGCAAGACAGGG + Intergenic
1130916639 15:88310327-88310349 AGCAGCACCTGCCCTAGACAAGG + Intergenic
1131407769 15:92180392-92180414 ATAAAGACATGCCCTAGACTGGG + Intergenic
1131574449 15:93572559-93572581 GGCAACACCTGCCTCAGACAAGG - Intergenic
1131984644 15:98030039-98030061 ATAAAGAACTGCCCTAGACTGGG + Intergenic
1134341395 16:13350077-13350099 AGGAAGCCCTGCCCTTGACATGG + Intergenic
1134388489 16:13796275-13796297 GGCAAGTTCTGCCATAGACACGG + Intergenic
1141714069 16:85716855-85716877 TGCCAGCCCTGCCCCAGACAAGG + Intronic
1142280815 16:89146653-89146675 AACAGGCCCTGCCCTGGACATGG - Intronic
1142396559 16:89835270-89835292 TGCAAGAGCTGCCCAAGCCAGGG - Intronic
1143447366 17:7017381-7017403 AGCAAGGCCTGCACGAGAGAGGG + Exonic
1146260315 17:31416428-31416450 AGCAACACCGGCCTGAGACAAGG - Intronic
1151676968 17:75603594-75603616 AGCAGTACCTGCCCTAGGCGGGG + Intergenic
1156330258 18:36115087-36115109 GGAAATACCTGCCCTAGAAATGG - Intronic
1157152483 18:45232126-45232148 AGCAAGAACTACCCGAGACTGGG + Intronic
1157509538 18:48260807-48260829 AGCAAAGCCTGCCCTAGGCCTGG + Intronic
1157567998 18:48692982-48693004 ACCAAGTCCTGCCTTAGAGAGGG - Intronic
1158091419 18:53718186-53718208 AGCAATACCTGCTCTAGACAAGG - Intergenic
1158885018 18:61818872-61818894 AGAAAGTCCTGGCCTAGAGATGG + Intronic
1160489490 18:79325155-79325177 AGCTAGTCCTGCTCTAGACTGGG - Intronic
1161974769 19:7602464-7602486 AGCAAGACGTGCCCAAGGCCGGG + Intronic
925874011 2:8296722-8296744 ATAAAGACATGCCCTAGACTGGG - Intergenic
927050839 2:19327085-19327107 AGCAAGACCTTCCCTCTACAAGG + Intergenic
928696973 2:33859177-33859199 ATAAAGAACTGCCCTAGACTGGG + Intergenic
929143570 2:38687242-38687264 GGCTAGACCTGCTCTAGGCAGGG + Intronic
930235683 2:48886910-48886932 AGCAAGAACAGGCCTAGAAATGG - Intergenic
930703010 2:54478194-54478216 GGGAAGACCTGCCACAGACAAGG - Intronic
932714103 2:74089158-74089180 AGCAAGCCCTCCCCTAGCCCTGG + Intronic
933092599 2:78138894-78138916 ATAAAGAACTGCCCAAGACAGGG - Intergenic
933597400 2:84296057-84296079 AGCAATATCTGCCCTAAGCATGG + Intergenic
933975059 2:87502800-87502822 AGCAAGACCTGCCCTGAATTGGG + Intergenic
935436859 2:103044835-103044857 ATAAAGACCTACCCAAGACAGGG - Intergenic
936318767 2:111448014-111448036 AGCAAGACCTGCCCTGAATTGGG - Intergenic
936743987 2:115551354-115551376 AGCAAGAACTTCCCAAGACTGGG + Intronic
937468024 2:122152009-122152031 ATCAAGAACTGCCCAAGACTGGG - Intergenic
938555292 2:132417972-132417994 GGCAAGACTTGCCCTGGAGAGGG - Intronic
938996385 2:136683263-136683285 AGCAAGCCCTGCCCAAGAAAAGG + Intergenic
939701664 2:145400049-145400071 AGCAGGACCTGTACTGGACAGGG + Intergenic
940220624 2:151347727-151347749 AGGAAGACCTACCCAAGACTGGG + Intergenic
941752158 2:169144677-169144699 AGGAAGCCATGCCCTAGAAAAGG + Intronic
941896967 2:170638927-170638949 AGCAAAACCAGCACTGGACATGG - Intronic
942428617 2:175885030-175885052 AGCTAGCCCTGCCCGAGAGAGGG + Intergenic
944141476 2:196461559-196461581 ATCAAGAACTGCCCAAGACTGGG + Intronic
947032351 2:225811398-225811420 ATAAAGAACTGCCCGAGACAGGG + Intergenic
948721648 2:239904631-239904653 TGCAGGCCCTGCCCTAGGCACGG + Intronic
1168964804 20:1892882-1892904 AGTAAGACCTCCCTGAGACATGG - Intergenic
1170448624 20:16457737-16457759 AGTAAGGCCTGCCCTAGATAAGG + Intronic
1172642609 20:36449798-36449820 AGCAAGAGCTGACCAATACAGGG - Intronic
1174396741 20:50251298-50251320 AGAAAGTTCTGCCTTAGACAAGG + Intergenic
1175415921 20:58800921-58800943 AGCAAGACCTCCCCAGGCCAGGG + Intergenic
1178945229 21:36941388-36941410 AGAAAGAACTGCCCAAGACTGGG - Intronic
1180936944 22:19632192-19632214 AGCAAGTGCTGCCCATGACATGG + Intergenic
1181727322 22:24820480-24820502 CGCATAACCTGCCCTAAACATGG - Intronic
1183327485 22:37202359-37202381 AGCAGGGCCTGCCAGAGACAGGG + Intergenic
1183480316 22:38060627-38060649 AGCAAGACCTCCCCCAGGCCTGG + Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1183594045 22:38799082-38799104 AGCAAGAGCAGCCCAAGAAAGGG - Intergenic
950185708 3:10944262-10944284 AACAAGACCTGCCCTCACCAAGG - Intergenic
950502770 3:13374918-13374940 AGCAGGACTCGCCTTAGACAGGG - Intronic
952141047 3:30479589-30479611 AGAAAGAACTGCCCAAGACTGGG - Intergenic
955333545 3:58067103-58067125 AGCAATGCCTGCCCTGGGCATGG - Intronic
955884678 3:63585014-63585036 AGCAAGATGTGTCCTAGAGAAGG - Intronic
958156112 3:89757836-89757858 GGCAAGACCTGGCAAAGACATGG - Intergenic
959125906 3:102290372-102290394 AGCAAGCCCTGCCCAAGCTAAGG - Intronic
962291872 3:134144348-134144370 AGAAAGATCTGCCAGAGACAGGG - Intronic
967500590 3:190192980-190193002 AGAATGACCTGCCCAAGTCAGGG - Intergenic
970735686 4:19164643-19164665 ATAAAGAACTGCCCAAGACAAGG - Intergenic
972017199 4:34262157-34262179 AGCAAGAGCTAGCCTACACAGGG + Intergenic
974457560 4:62147087-62147109 AGCAAGACCTTCACTAGATGAGG - Intergenic
976042563 4:80905558-80905580 ATAAAGAACTGCCCAAGACAGGG + Intronic
977305179 4:95315324-95315346 AGGAAGAGCTGCCCTGAACAAGG - Intronic
980678807 4:136127194-136127216 ATGAAGACCTACCCTAGACTGGG - Intergenic
981491965 4:145349010-145349032 ATCAAAAACTGCCCTAGACTGGG - Intergenic
981654903 4:147102032-147102054 AGCAAGGCAGGCCCTGGACAAGG + Intergenic
982574810 4:157096199-157096221 AGCCAGGCCTTCCCCAGACAGGG - Intronic
986000208 5:3625077-3625099 ATAAAGACATGCCCGAGACAGGG + Intergenic
987569006 5:19630855-19630877 AGCAAGACCTGAACTAGAAAGGG + Intronic
988025113 5:25675782-25675804 ATAAAGACATACCCTAGACAGGG + Intergenic
990832023 5:59969882-59969904 ATAAAGAACTGCCCTAGACGGGG - Intronic
991311492 5:65247987-65248009 AGCAAGTCATGCACTTGACAAGG + Intronic
992467261 5:77018687-77018709 AGCAAGAAGTACCCTAGAGAAGG - Intergenic
995997976 5:118323673-118323695 ATAAAGAACTGCCCAAGACAGGG + Intergenic
996303874 5:122023621-122023643 ACAAAGACCCTCCCTAGACACGG - Intronic
997651191 5:135522661-135522683 AGGAAGAACTGCCCAAGACAGGG + Intergenic
998044483 5:138975434-138975456 AGGAACACCTGCCTCAGACAAGG + Intronic
999299419 5:150481941-150481963 AGCAAGGGCTGCCAGAGACATGG + Intergenic
1001048541 5:168395149-168395171 GGCAAGACCTGACTCAGACAGGG - Intronic
1003029428 6:2589223-2589245 AGCAAGACCTGCCCAAGGAGAGG - Intergenic
1007997050 6:46318862-46318884 AGTTAGACCTTCCCTAGAAAAGG - Intronic
1008124770 6:47655895-47655917 AGCATAACCTACCCTATACAAGG - Intergenic
1010866067 6:80978092-80978114 AGCAAAGCCTGCCCAAGCCAGGG + Intergenic
1013519174 6:110916892-110916914 AGGAACACCTGGCCTACACAGGG + Intergenic
1014167569 6:118243316-118243338 ATTAAGAAATGCCCTAGACAAGG + Intronic
1014280159 6:119433347-119433369 AGAAAGAACTGCCCAAGACTGGG - Intergenic
1014756658 6:125309195-125309217 AGCATGGCCTCCTCTAGACATGG + Intergenic
1016389452 6:143560655-143560677 AGGGAGACCTGACCTAGACTGGG + Intronic
1017278571 6:152598406-152598428 ATAAAGACATACCCTAGACAGGG - Intronic
1017594385 6:156013272-156013294 CACAAGTCCTGCCCTAGACTTGG + Intergenic
1018933034 6:168254677-168254699 AGTGAGACCTGCCCAGGACAGGG + Intergenic
1020985119 7:15124057-15124079 ATCAAGACCTGCAGTAGAGATGG + Intergenic
1023537782 7:41231782-41231804 AGCAAGCCCTGCCCAAGAAGAGG - Intergenic
1027691684 7:81354561-81354583 AGCAAGCCCTGCCCAAGAAAAGG - Intergenic
1027729252 7:81849178-81849200 ATCAAGAACTGCCCAAGACTGGG + Intergenic
1028062022 7:86332010-86332032 ATCAAGACATACCCAAGACAGGG - Intergenic
1029035232 7:97513054-97513076 AGCAGGACCAGCCCCTGACAAGG + Intergenic
1029416534 7:100446596-100446618 AACAAGACCTCCCCTAACCATGG - Intergenic
1031495235 7:122438705-122438727 ATCAAAACCTCCCCTAGACCAGG + Intronic
1032790756 7:135240834-135240856 AGCGACAAATGCCCTAGACAGGG + Intronic
1038192844 8:25339629-25339651 AGCAGGACCTGCCCCAGGCAGGG + Intronic
1040107566 8:43549215-43549237 AGCAGGCCCTGCCCCAGACTTGG - Intergenic
1041114877 8:54525799-54525821 AGGAAGACCTGCGGAAGACAGGG + Intergenic
1047835720 8:128688663-128688685 ATAAAGAACTGCCCTAGACTGGG - Intergenic
1048784096 8:138032422-138032444 ATAAAGAACTGCCCAAGACAGGG + Intergenic
1049023537 8:139973497-139973519 ACCAAGACCTGACGTGGACAGGG + Intronic
1049477284 8:142802614-142802636 AGCCACACCTGCCCTAGGAAAGG - Intergenic
1049778002 8:144415308-144415330 AGCAAGACCCGCTCCTGACATGG + Exonic
1052003707 9:23320581-23320603 AACAACACCTGCCCTAGATGTGG + Intergenic
1054802054 9:69359656-69359678 AGCAAGAACTGCCCAAGACCAGG - Intronic
1055156327 9:73067046-73067068 AGCAAGCCCTGCCCAAGGAAAGG + Intronic
1056951764 9:91045871-91045893 AGCGTGTTCTGCCCTAGACAAGG + Intergenic
1058725271 9:107797339-107797361 ATAAAGACCTACCCTAGACTGGG + Intergenic
1059698204 9:116748744-116748766 ACCCAGTCCTGCCCTGGACAGGG + Intronic
1060260070 9:122066756-122066778 ATCAAGAACTGCCCCAGACTGGG + Intronic
1061133451 9:128720823-128720845 AGCGAGACCTGGCCCAGAAAGGG + Exonic
1061606181 9:131712566-131712588 AGGAGGAGCTGCCCCAGACACGG - Intronic
1185918144 X:4059026-4059048 AGCAATCCCTGCCTTAGAAATGG - Intergenic
1188147798 X:26635218-26635240 ATAAAGAACTGCCCTAGACTGGG - Intergenic
1194633127 X:96311386-96311408 ATAAAGACCTGCCCAAGACTGGG + Intergenic
1196231888 X:113233627-113233649 AGCAAGCCCTGCCCAAGAAGAGG - Intergenic
1196998683 X:121413717-121413739 ATAAAGAACTGCCCAAGACAGGG - Intergenic
1197142125 X:123129506-123129528 AGGAACACCTTCCCTAGCCAAGG + Intergenic
1199411415 X:147528288-147528310 AGAAAGACGTACCCAAGACAGGG - Intergenic