ID: 1128737620

View in Genome Browser
Species Human (GRCh38)
Location 15:70062107-70062129
Sequence GCTTCGGGCAGAAACTTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128737620_1128737625 19 Left 1128737620 15:70062107-70062129 CCGGCCAAGTTTCTGCCCGAAGC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1128737625 15:70062149-70062171 ATCAAGCCTTGAAGAAAAAATGG 0: 1
1: 0
2: 2
3: 39
4: 456
1128737620_1128737626 22 Left 1128737620 15:70062107-70062129 CCGGCCAAGTTTCTGCCCGAAGC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1128737626 15:70062152-70062174 AAGCCTTGAAGAAAAAATGGAGG 0: 1
1: 0
2: 3
3: 33
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128737620 Original CRISPR GCTTCGGGCAGAAACTTGGC CGG (reversed) Intronic
900319171 1:2074079-2074101 GCTCCGGGCAGCAACACGGCTGG + Intronic
901657056 1:10775473-10775495 GCATCCTGGAGAAACTTGGCCGG - Intronic
901937422 1:12636424-12636446 CTTTCAGGCAGAAACTTGGTTGG - Intergenic
903443181 1:23403643-23403665 ACTTGGGGCAGTAACTTGGATGG - Intronic
904329303 1:29747486-29747508 GCATCGGGCAGAGGCTTGGCAGG + Intergenic
904371202 1:30048523-30048545 GCATCGGGCAGAGGCTTGGCAGG + Intergenic
907838919 1:58137654-58137676 GCTTGGAGTAGACACTTGGCTGG - Intronic
909799603 1:79789548-79789570 GTTTCAGGCAGACTCTTGGCTGG - Intergenic
915013051 1:152707928-152707950 GCCTCTGGCTGAAATTTGGCTGG + Intergenic
915165719 1:153946705-153946727 GCTTTGGGCAGACGCTTGCCAGG - Intergenic
917486130 1:175456146-175456168 GGCTGGGGCAGAAACTTGCCTGG - Intronic
918344865 1:183598189-183598211 GCTTGGGGCAGGAATTTGGATGG - Intronic
919799181 1:201342672-201342694 GGTAGGGGCAGAAACTTGACTGG + Intergenic
923277037 1:232405512-232405534 GCTGGGGGCAGAATCCTGGCTGG + Intronic
924027960 1:239857027-239857049 TCTTTGAGCAGAAACTTGACTGG + Intronic
1065291907 10:24238914-24238936 GCTGTTGGCAGAAACTTAGCCGG - Intronic
1066070839 10:31809448-31809470 GCTTCTGGTAGATGCTTGGCAGG + Intronic
1069564907 10:69457320-69457342 GCTTGGGGCAGAGGCCTGGCTGG + Intronic
1069746438 10:70717730-70717752 GCTTCTGGCTGCAACCTGGCTGG - Intronic
1072408931 10:95183369-95183391 TTTTCGGGGAGAAGCTTGGCAGG + Intergenic
1073338669 10:102729236-102729258 GCTTCAGGGAGAAAGTCGGCTGG - Intronic
1080901119 11:36492322-36492344 GCTTTGGGCTGAATCTTGACAGG - Intronic
1089463020 11:118663797-118663819 GCTTATGGCAGAAACCTGGGAGG + Intronic
1099242266 12:80152407-80152429 GCTTCGAGCTGAAATTTGGGAGG - Intergenic
1107611150 13:42114302-42114324 TCTTCAGGCAGACCCTTGGCAGG - Intronic
1107763027 13:43702146-43702168 GATACGTGCAGCAACTTGGCTGG - Intronic
1108495957 13:51025662-51025684 GCGGCAGGCAGAAACTTGGCAGG - Intergenic
1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG + Intronic
1118154770 14:63228876-63228898 GCTTCTGGAAGAAACTCGGAAGG - Intronic
1118275864 14:64385928-64385950 GCTGAGAGCAGAAACTTTGCTGG + Intergenic
1122950819 14:105043566-105043588 CCTCTGGGCAGAAACTGGGCAGG + Intergenic
1123058680 14:105584539-105584561 ACTTCAGGGAGAGACTTGGCAGG + Intergenic
1123083007 14:105704765-105704787 ACTTCAGGGAGAGACTTGGCAGG + Intergenic
1125756076 15:42065870-42065892 GCTTAGGGCAGAATCTGGGAGGG + Intergenic
1127666011 15:61147867-61147889 GAAACAGGCAGAAACTTGGCAGG + Intronic
1128737620 15:70062107-70062129 GCTTCGGGCAGAAACTTGGCCGG - Intronic
1129892313 15:79079334-79079356 GCTTCTGTCAAAAACTTGGTTGG + Intronic
1130535798 15:84784158-84784180 GCTTTGGGCAGGAGGTTGGCAGG - Exonic
1132655555 16:1040483-1040505 ACTTCGGGGAGAACCTCGGCGGG - Intergenic
1134080824 16:11323781-11323803 GCTCCAGGCATAAACCTGGCGGG - Intronic
1137263958 16:46853451-46853473 GTTTCTGGCAGAAAATAGGCAGG - Intergenic
1140658203 16:77162187-77162209 GCCTCAGGGAGAAACCTGGCAGG - Intergenic
1142093839 16:88228923-88228945 GCATCGGGCAGAAGCCAGGCGGG + Intergenic
1142187144 16:88699949-88699971 GCCGAGGGCAGAAACCTGGCTGG + Intronic
1147658114 17:42102381-42102403 GGTCCAGGCAGAGACTTGGCCGG - Intronic
1148140333 17:45323543-45323565 GCTTAGGCCTGAAACTTGGAGGG + Intergenic
1150859898 17:68790573-68790595 GCTAATGGCAGAAACTGGGCTGG + Intergenic
1151210235 17:72538975-72538997 GCAGCGGGCAGAAACCGGGCTGG - Intergenic
1157367868 18:47082852-47082874 TCTGCGGGGGGAAACTTGGCAGG - Intronic
1158429085 18:57367582-57367604 TCTTAGGGAAGAAAATTGGCAGG + Exonic
1158462492 18:57658487-57658509 GCTAGGGGCAGAAACATGGTGGG + Intronic
1163365194 19:16872110-16872132 GATTCTGGCAGAAACCAGGCAGG - Intronic
926410508 2:12597462-12597484 GCTTTGTGCAGAAAAGTGGCTGG - Intergenic
928241740 2:29592455-29592477 TCTTGGGGCACAAACTTGGTGGG + Intronic
928744552 2:34396285-34396307 CCTTGAGGCATAAACTTGGCTGG + Intergenic
929174144 2:38960097-38960119 GCATCGGGCAGGAGCTCGGCCGG - Exonic
934793115 2:97079959-97079981 GCATCTGTAAGAAACTTGGCTGG - Intergenic
934813075 2:97300584-97300606 GCATCTGTAAGAAACTTGGCTGG + Intergenic
934824620 2:97407896-97407918 GCATCTGTAAGAAACTTGGCTGG - Intergenic
941766588 2:169304022-169304044 CCTTCTGGCAAAAACCTGGCAGG - Intronic
947553773 2:231069085-231069107 GCTTTGGGCAGGAACTTTGTTGG - Intronic
1171983444 20:31643168-31643190 GCTTCAGGCAAACAGTTGGCTGG - Intronic
1172015652 20:31870869-31870891 GCTTCTAGCAGAAACGTGACGGG + Intronic
1175241490 20:57552738-57552760 GCTTTTGGCAGAAAATTGGAAGG + Intergenic
1182354368 22:29715756-29715778 GCTGGGAGCAGAAACTTGGGGGG - Intergenic
1184474920 22:44715166-44715188 GCTTGGGGCAGCAGCTTGTCGGG - Intronic
953009790 3:39014045-39014067 CCTTCGAGCAGAACCTTGGCTGG + Intergenic
956114230 3:65902682-65902704 GGTACGAGCAGAGACTTGGCAGG - Intronic
959594753 3:108117659-108117681 GCTTCAGTGAGAAAATTGGCTGG + Intergenic
962087287 3:132205042-132205064 GCTTCAGGCTGAAAGTTGGCTGG + Intronic
962173532 3:133128110-133128132 GCTTGGGTCTGAAACTTGGTTGG + Intronic
964540147 3:157770368-157770390 ACTACGGGCAGAGACTTGGTGGG - Intergenic
968548225 4:1209418-1209440 GCTTGGGGGAGACAGTTGGCAGG + Intergenic
969527256 4:7710197-7710219 GCTTTGCGCAGAAACATGGCGGG - Intronic
969702561 4:8775823-8775845 GCTTCGGGCACAGAGCTGGCAGG - Intergenic
969946340 4:10787155-10787177 GCTTCAGGGAGAGCCTTGGCAGG + Intergenic
979509692 4:121538202-121538224 GCTTTTGGCAGCAACTTGGATGG - Intergenic
980216937 4:129864377-129864399 GCATGGAGCTGAAACTTGGCAGG + Intergenic
990116940 5:52401270-52401292 TCTTCTGGGAGAAAATTGGCAGG - Intergenic
990817712 5:59804323-59804345 GTCTCTGGCAGCAACTTGGCTGG - Intronic
993706153 5:91172937-91172959 TCTTAAGGCAGAAACGTGGCTGG - Intergenic
999104200 5:149054965-149054987 GCTTAGGGCAGAAAATTGCAAGG + Intronic
1001223829 5:169926942-169926964 GCTTGGGGCAGAAATGAGGCTGG + Intronic
1004921001 6:20375466-20375488 GCTTCCACCAGAAACTTGGAAGG - Intergenic
1013090364 6:106894978-106895000 GTTTCTGGGAGATACTTGGCAGG - Intergenic
1018745493 6:166758462-166758484 GCTTCTGGCAGAACCAAGGCAGG - Intronic
1019441966 7:1052122-1052144 GCTGCAGGCAGCATCTTGGCTGG - Intronic
1022980567 7:35601475-35601497 TCTTCTGACTGAAACTTGGCTGG + Intergenic
1029573334 7:101386207-101386229 GCTCAGGGCAGACACTCGGCAGG - Intronic
1048196886 8:132338759-132338781 GCTTCTGGCAGAAAATAGGCAGG + Intronic
1048329746 8:133463611-133463633 GCTGTGGGCAGAAACCCGGCTGG - Intronic
1049574220 8:143383016-143383038 GCACCAGGCAGAAACTTGGCTGG - Exonic
1051271306 9:15357965-15357987 GCTTCGGGACTCAACTTGGCGGG - Intergenic
1053036536 9:34831421-34831443 GCTGCTGGCAGTAACTTGACAGG + Intergenic
1054713115 9:68530995-68531017 GCTTCTGTCAGAAACTTGCTAGG + Exonic
1056128993 9:83565582-83565604 GCTACGGGCAGTATCTTTGCAGG - Intergenic
1056906300 9:90651459-90651481 GTTTGCAGCAGAAACTTGGCAGG + Intergenic
1057185760 9:93056952-93056974 GCTTCTGGCAGTTCCTTGGCCGG - Intergenic
1061661615 9:132133930-132133952 GTTTCGGGTGGAAATTTGGCAGG + Intergenic
1200854847 Y:7926409-7926431 CCTGTGGGCAGAAACATGGCAGG + Intergenic