ID: 1128740290

View in Genome Browser
Species Human (GRCh38)
Location 15:70079039-70079061
Sequence CCTCATAACCAGAGTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128740290_1128740294 -6 Left 1128740290 15:70079039-70079061 CCCAGCTCACTCTGGTTATGAGG 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1128740294 15:70079056-70079078 ATGAGGACAACGGATCTCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 63
1128740290_1128740298 13 Left 1128740290 15:70079039-70079061 CCCAGCTCACTCTGGTTATGAGG 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1128740298 15:70079075-70079097 CAGGATTTATGTAGCCATCCGGG 0: 1
1: 0
2: 1
3: 5
4: 108
1128740290_1128740299 21 Left 1128740290 15:70079039-70079061 CCCAGCTCACTCTGGTTATGAGG 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1128740299 15:70079083-70079105 ATGTAGCCATCCGGGCCATCAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1128740290_1128740297 12 Left 1128740290 15:70079039-70079061 CCCAGCTCACTCTGGTTATGAGG 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1128740297 15:70079074-70079096 CCAGGATTTATGTAGCCATCCGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128740290 Original CRISPR CCTCATAACCAGAGTGAGCT GGG (reversed) Intronic
900403375 1:2482043-2482065 CCTAATTGCCAGAGTGCGCTGGG + Intronic
901122315 1:6905823-6905845 CCTCATATACAGAGTGTGCTCGG + Intronic
903186089 1:21629820-21629842 CCTCATTGCCTGTGTGAGCTTGG - Intronic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
908388224 1:63662613-63662635 CCCCAGAACCACAGTGAGCTTGG - Intergenic
908757549 1:67482698-67482720 CTTTATAACCATAGTGAGATGGG - Intergenic
909590539 1:77343681-77343703 CCTCATAATCACACTGAGGTAGG - Intronic
912296393 1:108474631-108474653 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
917722921 1:177803236-177803258 CCACATTTCCAGAGTGAGTTTGG - Intergenic
919153798 1:193734633-193734655 GCCCATAACCAGAATGTGCTTGG - Intergenic
920728567 1:208461307-208461329 TCTCATAAGAAGAGTGACCTTGG - Intergenic
920871443 1:209798398-209798420 CTTCATAGCCCGAGTCAGCTGGG - Intronic
922549057 1:226480661-226480683 CCTGAGAACCAGGGTGAGGTGGG - Intergenic
922934738 1:229414064-229414086 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
923770822 1:236936285-236936307 CCTCCTCACCAGGCTGAGCTAGG - Intergenic
1065797390 10:29319749-29319771 CCTCATCATCAGAGTAACCTGGG + Intergenic
1066491508 10:35899297-35899319 CCTCATCACCATAGCCAGCTTGG + Intergenic
1071185418 10:83038286-83038308 CTTCATAACAACAGTGAGGTAGG + Intergenic
1072441968 10:95464952-95464974 CCACAAAGTCAGAGTGAGCTTGG + Intronic
1075387992 10:122071324-122071346 CCCCATAGCCAGAATGAACTTGG - Intronic
1076771668 10:132669453-132669475 CCACAGAACGAGAGGGAGCTGGG + Intronic
1078252153 11:9624991-9625013 GCCAATAACCAGAATGAGCTTGG + Intergenic
1078565693 11:12412218-12412240 CCTCATGTCCAGCGTGAGCCTGG + Intronic
1078896691 11:15603351-15603373 TCTAATATCCAGAGTGGGCTAGG + Intergenic
1079897068 11:26133606-26133628 CCTCATTGCCAGAATTAGCTGGG - Intergenic
1080321107 11:31010320-31010342 CCTAACAACCTGAGGGAGCTTGG - Intronic
1082091083 11:48090364-48090386 CTTCAAGACCAGTGTGAGCTGGG - Intronic
1082191297 11:49248431-49248453 CCTCATGACCTGTGTGAGGTTGG + Intergenic
1082794036 11:57367307-57367329 CCAAATAAGCAGAGTGAGCTGGG + Intronic
1082890365 11:58132697-58132719 CCTCATCCCCAGGGTGAGGTTGG + Intronic
1084965711 11:72743516-72743538 CCTCCTGAGCAGGGTGAGCTGGG - Intronic
1086074956 11:82840864-82840886 TTTCATAACCAGAGACAGCTGGG - Intronic
1086136358 11:83446962-83446984 CCTCCTTGCCAGACTGAGCTAGG - Intergenic
1088808021 11:113369498-113369520 CCTCATAACGACTGTGAGGTGGG + Intronic
1090331872 11:125939024-125939046 CCTCATTACCTGTGTCAGCTGGG - Intergenic
1090961714 11:131563040-131563062 TCTCATTCCCAGAGTGACCTTGG + Intronic
1091242031 11:134059492-134059514 ACTCAGCACCAGAGAGAGCTTGG - Intergenic
1094098135 12:26731248-26731270 CCTCATAACCATAGGGAACATGG + Intronic
1094825675 12:34267307-34267329 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
1096506843 12:52099080-52099102 CCTCATATCCAGAGGGAGAGAGG - Intergenic
1099503909 12:83448564-83448586 CCTCATAACCAGTGGGAGATAGG + Intergenic
1100085060 12:90900662-90900684 CCTTAGAACAAGAATGAGCTTGG + Intergenic
1101436306 12:104667723-104667745 CCTCACAACCAGCCTGAGGTAGG - Intronic
1102260938 12:111442937-111442959 CCTCATAACCAGCTTGAGTGGGG - Intronic
1106976510 13:35223921-35223943 GCTAATAACCTGAGTGAGCCTGG - Intronic
1108257744 13:48627161-48627183 CCTCATACCCAGTTTAAGCTGGG - Intergenic
1108459656 13:50652490-50652512 CCTCTCATCCAGAGTGAGCTAGG + Intronic
1108490304 13:50975066-50975088 CCACATAGCCAGAGTAAGCATGG - Intergenic
1108814046 13:54268537-54268559 CCTCCTCGCCAGACTGAGCTAGG + Intergenic
1110544682 13:76743472-76743494 CATCATAGCCTGAGTGAACTAGG + Intergenic
1111690138 13:91553511-91553533 CCTCATATACAGATTGAACTGGG - Intronic
1112312441 13:98330953-98330975 CCTCATTTCCAGAGTGCCCTTGG + Intronic
1112932848 13:104763156-104763178 GCTCTTAACCTGAGTGGGCTAGG + Intergenic
1113204838 13:107905382-107905404 CCACATAAAAAGAGTGAGATGGG + Intergenic
1114891438 14:26929005-26929027 TCTAGCAACCAGAGTGAGCTTGG + Intergenic
1115314903 14:32015276-32015298 CCTCATAAACAGAGTGACCAAGG + Intronic
1116519437 14:45831682-45831704 CCTAATATCCAGAGGGAGATAGG - Intergenic
1122150899 14:99725669-99725691 CTTTAGAACCAGACTGAGCTGGG - Intronic
1127055394 15:55126062-55126084 ACTCATGACCAGAGTTAGATAGG - Intergenic
1127466254 15:59247659-59247681 GCTTTTAAGCAGAGTGAGCTGGG + Intronic
1128740290 15:70079039-70079061 CCTCATAACCAGAGTGAGCTGGG - Intronic
1128946572 15:71826825-71826847 CCTCATTACCTGAGGCAGCTCGG + Exonic
1130930878 15:88426798-88426820 CCTCCTAACCAGGATGAGCTAGG - Intergenic
1132262930 15:100441937-100441959 CCTCCTCACCAGGCTGAGCTAGG + Intronic
1133155643 16:3873634-3873656 CCTCATAACCACCCTGAGATGGG + Intronic
1133283325 16:4679316-4679338 CCTCTTATGCTGAGTGAGCTGGG + Intronic
1133418766 16:5627395-5627417 CCTTTTAACCATAGTGATCTTGG + Intergenic
1134220671 16:12351312-12351334 CCCCACAACCAGAGTAAACTGGG + Intronic
1135716884 16:24778561-24778583 CCTTATTACCTGTGTGAGCTTGG + Intronic
1136599298 16:31273812-31273834 CCTCAGAAACAGAGAGAGCCTGG - Intronic
1140556851 16:75931195-75931217 CCACATAACCACAGTCAGGTTGG - Intergenic
1140741746 16:77947754-77947776 CCTCAAAAACAGAGGGAGGTAGG - Intronic
1141799308 16:86296263-86296285 CCTGATAAGCAGAGTGAGTCTGG - Intergenic
1203121010 16_KI270728v1_random:1537359-1537381 CCTTAAATCCAGAGTGGGCTGGG - Intergenic
1145792596 17:27637387-27637409 GCTCATGACCTGAGTGACCTTGG - Intronic
1151868807 17:76822616-76822638 GCTCATACCCAGAGGGTGCTAGG - Intergenic
1157574173 18:48732647-48732669 CCTCATGTCCAGAAGGAGCTGGG - Intronic
1165317103 19:35063123-35063145 CCTCCTTACCAGGGTGTGCTGGG - Intronic
925492241 2:4407621-4407643 GCTGACAACCTGAGTGAGCTTGG + Intergenic
925841660 2:7997779-7997801 CCTCATAAACTGACAGAGCTGGG + Intergenic
929230901 2:39558917-39558939 CCAGATAACCAGAGAGAGGTTGG - Intergenic
931669520 2:64634575-64634597 CGTGATCACCACAGTGAGCTTGG - Exonic
932498428 2:72159351-72159373 CCTCATTACTAAACTGAGCTTGG + Intergenic
932909246 2:75788574-75788596 GCTAATCACCAGAGTGACCTTGG + Intergenic
934768255 2:96892612-96892634 CCTCTGTACCAGAGTGAGCCTGG + Intronic
935014200 2:99164478-99164500 ACTCATAAACAGAGGGAGCTGGG - Intronic
943788793 2:191908639-191908661 CCTCGTAGCCAGAGGGATCTTGG + Intergenic
946381676 2:219353086-219353108 CCCCATGACCAGGGTGAGCAGGG - Intergenic
947181609 2:227416357-227416379 CCTCATAACCACAATGGGCTGGG - Intergenic
948428716 2:237904819-237904841 CCTCTTACCCAGAGTGATCCTGG - Intronic
1170436937 20:16340014-16340036 ACTCATACCCTGAGTGAGATGGG - Intronic
1171392114 20:24808385-24808407 TTTTAAAACCAGAGTGAGCTGGG - Intergenic
1175397360 20:58675547-58675569 CCTCGTCCCCAGATTGAGCTTGG + Intronic
1175656157 20:60772836-60772858 CCTCATGCCCAGATAGAGCTGGG - Intergenic
1176408801 21:6436683-6436705 CGTCACAATCGGAGTGAGCTGGG - Intergenic
1177102596 21:16915642-16915664 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
1179684294 21:43045005-43045027 CGTCACAATCGGAGTGAGCTGGG - Intergenic
1181086891 22:20444248-20444270 TCTTCTAACCAGAGTGAGCAGGG + Intronic
1181592024 22:23891324-23891346 GCTCACAACCAGATTGAACTTGG - Intronic
1181796157 22:25312465-25312487 GCTCTTACCCAGAGTGAGGTGGG + Intergenic
1181836703 22:25616075-25616097 GCTCTTACCCAGAGTGAGGTGGG + Intronic
1183354941 22:37353204-37353226 CCGCAGAACCAGATAGAGCTGGG - Intergenic
1185137410 22:49080649-49080671 CCTCCTGAGCACAGTGAGCTGGG - Intergenic
949204194 3:1418549-1418571 CTTCATTACAAGAATGAGCTTGG + Intergenic
949884908 3:8685054-8685076 CCTCATATCCAGAGGGAGAGAGG - Intronic
951282582 3:20771043-20771065 CCTCATACTCATAGTGATCTGGG + Intergenic
953415971 3:42717800-42717822 GCTAACAACCTGAGTGAGCTTGG - Intronic
954379696 3:50213028-50213050 CCTCATAACCAGAGGTGGCTGGG - Intronic
955364045 3:58296897-58296919 CCTCATAAGCTGTGTGACCTTGG - Intergenic
956251558 3:67239451-67239473 CCTTATAACCTGTGTGTGCTGGG - Intergenic
956389239 3:68753813-68753835 GCCAATAACCAGAGTGAGCCTGG + Intronic
958617754 3:96517162-96517184 CATCTTAACCAGAGGAAGCTGGG + Intergenic
959112688 3:102140887-102140909 GCTAATAACCAGAATGATCTAGG - Intronic
959809255 3:110595586-110595608 CAGCATAACCAGAATGACCTTGG + Intergenic
960253100 3:115479046-115479068 CTTCATAAAGAGAGTAAGCTGGG + Intergenic
963851212 3:150212422-150212444 GCCGATAACCTGAGTGAGCTTGG - Intergenic
964300335 3:155279238-155279260 CCTCCTCACCAGGCTGAGCTAGG - Intergenic
964604608 3:158546834-158546856 CCTCATAACTAGAGAGTGCCAGG - Intergenic
965336240 3:167432869-167432891 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
966642088 3:182203049-182203071 CCCCATGACCAGAGTGAATTCGG - Intergenic
969810029 4:9640553-9640575 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
969927458 4:10598334-10598356 CCTCATCAACAGGGTGACCTTGG + Intronic
971514170 4:27466073-27466095 CCCCAAAACCAGAGTAAGCCTGG - Intergenic
973638021 4:52877712-52877734 CCCCATAACTACTGTGAGCTGGG - Intronic
976614250 4:87059967-87059989 ACTCCAGACCAGAGTGAGCTGGG - Intronic
978031393 4:103942792-103942814 CCTCCTAGCCAGGCTGAGCTAGG + Intergenic
981203194 4:142007751-142007773 AGTCATAACCAGAGTAATCTAGG - Intergenic
983380428 4:166984934-166984956 CTTTATAACCAAAGTGAGTTTGG + Intronic
985435639 4:189927499-189927521 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
988393594 5:30668178-30668200 CCTCATAACAATTCTGAGCTTGG - Intergenic
988442193 5:31245532-31245554 CCTCTTAACCCCCGTGAGCTGGG - Intronic
990796390 5:59546329-59546351 CATCAAAATCATAGTGAGCTAGG + Intronic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992493721 5:77271106-77271128 ACTCATCACCATAGTGACCTGGG - Intronic
993188884 5:84655421-84655443 CCTCATGGCCAGAGTGTTCTAGG + Intergenic
995523612 5:113033239-113033261 CCTGATGACAAGAGTCAGCTGGG - Intronic
995926775 5:117384406-117384428 CCACATATGCAGAGTGAGCCAGG - Intergenic
997652609 5:135533731-135533753 CCTCACAGCCAGGGTGAACTCGG + Intergenic
997788857 5:136738553-136738575 GCTCGTCACCAGAGTGAGCCAGG + Intergenic
998693792 5:144615412-144615434 CCTCCTCACCAGGCTGAGCTAGG - Intergenic
998973710 5:147621246-147621268 CCACAAAGCCAGTGTGAGCTGGG + Intronic
1000503587 5:162085071-162085093 CCTCATAACCTGCATGACCTTGG - Intronic
1006672116 6:35736020-35736042 CCTTCTAACCAGAGTGACCTTGG - Intergenic
1009748399 6:67850454-67850476 CATCTTACCCAGATTGAGCTAGG + Intergenic
1013673685 6:112433494-112433516 CCTCAAAACCAGGTTGAGGTTGG + Intergenic
1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG + Intergenic
1022568483 7:31427666-31427688 CCTCAAAAGGAGAGTCAGCTAGG - Intergenic
1024771434 7:52728120-52728142 CCTCATAATCAAATTGAGATAGG + Intergenic
1029473439 7:100768709-100768731 CCTCTGAACCTGGGTGAGCTGGG + Exonic
1032391925 7:131560851-131560873 CCTAATAGGCAGAGTGTGCTAGG + Intergenic
1034142265 7:148832241-148832263 CCTCAAAACAAAAGTTAGCTGGG - Intronic
1034695677 7:153051195-153051217 ACCAATAACCCGAGTGAGCTTGG + Intergenic
1034884087 7:154784257-154784279 CCTCATAAGGAGAGAGACCTAGG + Intronic
1038411530 8:27362984-27363006 CCTCATGGCCAGAGTCAGCTGGG + Intronic
1038737819 8:30188299-30188321 TCTCAGAAACTGAGTGAGCTGGG + Intergenic
1039860129 8:41449967-41449989 TCTCAAAACCAGTGTAAGCTGGG + Intergenic
1040638282 8:49301319-49301341 CCTCAGATGAAGAGTGAGCTAGG + Intergenic
1043717985 8:83509176-83509198 CCTCCTCACCAGGCTGAGCTAGG - Intergenic
1048135381 8:131742376-131742398 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
1048875940 8:138837243-138837265 CCTTATAACCAGAGTGAAAGAGG - Intronic
1049030707 8:140035501-140035523 CCTCACAACCAGTGTGTGTTAGG + Intronic
1049664261 8:143836013-143836035 CACCAGAAGCAGAGTGAGCTGGG + Exonic
1049774919 8:144399771-144399793 CCTCACCACCAGCGTGAGTTGGG - Exonic
1058543361 9:106035298-106035320 GCCCATAACCTGAATGAGCTTGG - Intergenic
1185744531 X:2561647-2561669 CCTCATTTCCAGAGTAAGCAGGG + Intergenic
1186524487 X:10236037-10236059 CCTCAGAGCCAGCGTGTGCTGGG + Exonic
1186567075 X:10674632-10674654 CTTTATAACCAGAATGAGCATGG + Intronic
1187965987 X:24612212-24612234 GCTAACAACCTGAGTGAGCTTGG + Intronic
1190109310 X:47579680-47579702 CGTCAGAACCAGAGTCAGCGAGG + Intronic
1190451176 X:50582214-50582236 GCTCAGAACTAGAGTGAGCTTGG + Intergenic
1190562343 X:51697683-51697705 GCCCATAACCTGAATGAGCTGGG + Intergenic
1192261861 X:69510436-69510458 CCTCATACCCAGTGTTAGCAAGG - Intronic
1196017690 X:110956930-110956952 CTTCATCACCAGGCTGAGCTAGG - Intronic
1198951499 X:142077629-142077651 CCTCACAAACTGTGTGAGCTTGG + Intergenic
1199319580 X:146422652-146422674 CCTCACAAACTGTGTGAGCTTGG + Intergenic
1199374890 X:147096759-147096781 CTATATAAACAGAGTGAGCTTGG + Intergenic
1199644548 X:149893698-149893720 CCACATAATCAAAGTGAACTTGG + Intergenic