ID: 1128741145

View in Genome Browser
Species Human (GRCh38)
Location 15:70084511-70084533
Sequence AACTGATGCCTGTAGTATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128741145 Original CRISPR AACTGATGCCTGTAGTATGG TGG Intronic
902828800 1:18996300-18996322 AAATGATGCCTGTAAAGTGGAGG - Intergenic
903853041 1:26319738-26319760 AACTGAGGACTGTTTTATGGAGG + Intronic
906627701 1:47338912-47338934 AACTAATGCATGTAAAATGGTGG - Intronic
907300155 1:53481978-53482000 ACCTGATGCGTGTCGTGTGGGGG - Intergenic
908993435 1:70123845-70123867 AACTCATGGCTGTAGTTTGGTGG + Intronic
919025102 1:192157977-192157999 AACTCATGCCTGTAATCTGGAGG - Intergenic
1065477974 10:26161492-26161514 TACTGAAGGCAGTAGTATGGTGG + Intronic
1069954364 10:72040684-72040706 AACTAAGGCCTGAAGTATGAGGG - Intergenic
1070512417 10:77173699-77173721 AACTGCTGTCTGTAGTCTGTGGG - Intronic
1073524925 10:104171484-104171506 GACTGATGCCTCTAGGAGGGAGG - Intronic
1077805236 11:5584431-5584453 CACCGAGGCCTGTAGTGTGGTGG - Intronic
1077813151 11:5658987-5659009 CACTGAGGCCTGTGGTAGGGTGG + Intergenic
1084789815 11:71466753-71466775 AACTGAAGCCATTAGTATGTCGG + Intronic
1088996752 11:115007192-115007214 TACTGATGCATGAAGTGTGGGGG - Intergenic
1091782989 12:3225553-3225575 GCCTGATGCCTGTGGGATGGGGG + Intronic
1104669091 12:130668113-130668135 AACTGGTGTCTGCAGTGTGGGGG + Intronic
1105629586 13:22148958-22148980 AACTGAGCCCTGGTGTATGGGGG + Intergenic
1107577457 13:41742316-41742338 GCATGATGCCTGGAGTATGGTGG - Intronic
1112672202 13:101653248-101653270 AACTGAGGCCAGTATCATGGTGG + Intronic
1117985028 14:61378765-61378787 AACTGATGCAGGTAGGGTGGAGG - Intronic
1121759033 14:96428119-96428141 CACTGAGGCCTGTCGTAAGGTGG - Intronic
1126415362 15:48412568-48412590 AACTGATGCCTCCAATATCGAGG - Exonic
1128334770 15:66778909-66778931 AAGCGATGCCTGGAGTATGCTGG - Intronic
1128741145 15:70084511-70084533 AACTGATGCCTGTAGTATGGTGG + Intronic
1129732690 15:77941012-77941034 GACCGATACCTGTAGCATGGAGG - Intergenic
1131850934 15:96542517-96542539 AACTGAGGCCTGCACTATGTTGG - Intergenic
1135634032 16:24058886-24058908 TATTGATCCCTGTAGGATGGAGG + Intronic
1136005514 16:27326372-27326394 AGCTCATGCCTGTAGCATGTTGG + Intronic
1137249770 16:46732930-46732952 AACTGAGGCCTGTAGGCGGGAGG + Intronic
1138257494 16:55579155-55579177 AAGGGAAGCCTGTAGAATGGTGG - Exonic
1139821634 16:69725942-69725964 AACTGATGCCTTTGGTTTGACGG - Intronic
1141769478 16:86080703-86080725 ATCAGAAGCCTGGAGTATGGGGG - Intergenic
1144169603 17:12647274-12647296 AAGGGATGCTTGAAGTATGGTGG + Intergenic
1156477979 18:37418262-37418284 ATCTAATGACTGTAGCATGGAGG + Intronic
1157952888 18:52060108-52060130 AACTGAGGGCTGGAGTATAGAGG - Intergenic
1158906618 18:62019269-62019291 AACTGATACCTGTAGTATTTTGG + Intergenic
1159200068 18:65172269-65172291 CACTGATGCCTGTCGTGGGGTGG + Intergenic
1161342811 19:3752336-3752358 AACTGAGGCCTGGAGAAGGGAGG - Intronic
1163758820 19:19121890-19121912 AACGGATGCCTGAGGGATGGGGG - Intronic
1166730854 19:45058250-45058272 AACAGATGCCTGGCGGATGGGGG - Intronic
925569666 2:5295635-5295657 CCCTGATGCCTGCAGCATGGAGG + Intergenic
926459423 2:13110361-13110383 ACCTGCTGCATGAAGTATGGAGG + Intergenic
928904176 2:36354046-36354068 AAATGATTCCTGTAGTTGGGTGG - Intergenic
929466734 2:42151784-42151806 AACTGTGGCCAGTAGAATGGGGG + Intergenic
936946089 2:117932382-117932404 AACAGAAGCCTATAGTGTGGAGG - Intronic
937124151 2:119462608-119462630 AAGTTATGCCTGTAGAATTGTGG + Intronic
942134655 2:172912795-172912817 AACTGATGCCTGCAGGAATGTGG - Intronic
943180276 2:184531180-184531202 CACTGATGCCCGAAGTCTGGAGG + Intergenic
1170582911 20:17712242-17712264 AACTGAAGCCTGGAGTCAGGAGG - Intronic
1174874543 20:54212440-54212462 TGCTGATGCCTGTGGTTTGGTGG + Intronic
1179745132 21:43439917-43439939 ACCTGAAGCCTGTAGTATCCTGG - Intergenic
1183035571 22:35138642-35138664 AACTGAGGCTTGTAGCATTGTGG - Intergenic
1183653528 22:39172161-39172183 AACTGAGGCCTCTAATCTGGGGG + Intergenic
1184191653 22:42898972-42898994 AACAGATGCATGCAGGATGGAGG - Intronic
1184699775 22:46162788-46162810 AACTCCTGCCTCTAGTTTGGGGG - Intronic
949297444 3:2542099-2542121 AAATGATGCCTCTAATGTGGTGG - Intronic
950050464 3:9984771-9984793 AAGTGATCGCTGTAGTATAGTGG + Intronic
950099895 3:10350247-10350269 AACTGAGGCCTGGAGAAGGGAGG + Intronic
951104907 3:18731565-18731587 AACTGGTGCCTTTGCTATGGAGG - Intergenic
954304029 3:49716202-49716224 AACCGAGGCCTGTAGTGTGTTGG - Intronic
956720352 3:72111889-72111911 AGGTGATGCCTGTAGGATAGAGG + Intergenic
961554608 3:127689430-127689452 AACTGAGGCCTGTAGGGTTGCGG + Exonic
964481444 3:157142632-157142654 AACTGTGGCCTGGAGTATTGTGG + Intergenic
964652365 3:159026295-159026317 TCCAGATGCCTGTAGTATAGAGG + Intronic
966615414 3:181908028-181908050 AAAAGATGCCTGAAGTTTGGTGG + Intergenic
967371779 3:188754816-188754838 AACTGAAGGCTCTAGGATGGTGG - Intronic
969054994 4:4396195-4396217 CACTGATGCCTGCAGAGTGGCGG + Intronic
974972040 4:68842607-68842629 CACTCATGCCTTTAGTCTGGTGG + Intergenic
975019282 4:69467303-69467325 AACTACTGCCTGTAGCAGGGTGG - Intergenic
977411834 4:96675814-96675836 ACCAGATGACTGTAGCATGGTGG + Intergenic
977960876 4:103084011-103084033 CACTGTTGCCTGTAGTGTGAAGG - Intronic
980523280 4:133958513-133958535 AACTGATGCCAGGAGTAGTGGGG - Intergenic
981926646 4:150147718-150147740 AACTGATGCTGGAAGTATGCAGG + Intronic
986465602 5:8019528-8019550 CATTCATGCCTGTAGTATGGAGG + Intergenic
988082164 5:26428288-26428310 CACTGAGGCCTGTTGTGTGGTGG - Intergenic
988657881 5:33232584-33232606 ATCTGATCCCTGTAGAATGAAGG - Intergenic
990643154 5:57811021-57811043 AACTGGGGCCTGTTGTAGGGTGG + Intergenic
991280178 5:64904552-64904574 AAGTGATTCCTTTGGTATGGTGG + Intronic
991319184 5:65350299-65350321 AACTTATGCCTGAAGGATGGAGG - Intronic
997873778 5:137529650-137529672 CACTGAGGCCTGTCGTAGGGTGG + Intronic
1001249795 5:170138221-170138243 AGCTGATTCCTATAGGATGGGGG + Intergenic
1007070964 6:39037834-39037856 CACTGATGCCTGCAGGAGGGAGG + Intergenic
1012113219 6:95261924-95261946 AAATGTTGTCAGTAGTATGGGGG - Intergenic
1013893161 6:115050780-115050802 AACGGATGGTTGGAGTATGGAGG + Intergenic
1019885832 7:3904191-3904213 AACTGATTCATGCAGTATGTGGG - Intronic
1020491896 7:8796426-8796448 AAATCATTCCTGTAGTTTGGGGG + Intergenic
1028802448 7:94981980-94982002 CACTGAGGCCTGTAGTGGGGTGG - Intronic
1031384928 7:121137770-121137792 AACTGTTGTCTAGAGTATGGTGG + Intronic
1032246345 7:130217014-130217036 ATCTGATTCCTGGAGTAGGGAGG + Intergenic
1032666980 7:134046640-134046662 AACTGAGGCCTGGAGTACTGGGG - Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1036096880 8:5734083-5734105 AGCGGGTGCCTGCAGTATGGTGG + Intergenic
1039454157 8:37696807-37696829 AACTTATTCCTTTAGTTTGGGGG - Intronic
1042873397 8:73418429-73418451 ATCTGGTGCCTATATTATGGTGG + Intergenic
1042979975 8:74516088-74516110 AACTTATATCTTTAGTATGGAGG + Intergenic
1046767169 8:118082241-118082263 AACTGAGGCCTGTTGTATCCAGG + Intronic
1047670595 8:127142070-127142092 AACTGTTGGGTGTAGTAGGGTGG + Intergenic
1048859000 8:138709622-138709644 CACTGGGGCCTGTAGTAGGGTGG + Intronic
1050424071 9:5496017-5496039 AACTGTTGCCAGTAGTATTCTGG + Intergenic
1051058597 9:13018401-13018423 AACTGGTACCTCTACTATGGGGG + Intergenic
1051394771 9:16607980-16608002 GACTGATGCTTGTACCATGGGGG - Intronic
1052418431 9:28208277-28208299 AACTGCTGCCTGTGGGGTGGGGG + Intronic
1052440809 9:28494373-28494395 TACTGAGGCCTGTAGTGGGGTGG - Intronic
1056496251 9:87158186-87158208 ACATGATGCCTTGAGTATGGAGG - Exonic
1056753744 9:89369379-89369401 AAATGCTGCCTAAAGTATGGGGG + Intronic
1057304680 9:93905207-93905229 AACTGAGGCCTGAAGAAGGGAGG - Intergenic
1058185814 9:101853332-101853354 CACTGAGGCCTGTTGGATGGTGG + Intergenic
1061229382 9:129305319-129305341 AACTAATGCCTGTTCTAAGGTGG - Intergenic
1061295445 9:129674469-129674491 AGCTGAGGCCTGTAGGATTGGGG + Intronic
1061357333 9:130116356-130116378 AACTGATGACTGCAGTATTTAGG + Intronic
1061485411 9:130918107-130918129 AACTGAAGCCTGGGGTTTGGAGG - Intronic
1061720717 9:132549491-132549513 TACTGATCCATGTAGAATGGGGG - Intronic
1193998196 X:88392483-88392505 AACTGATACCTATAGTAATGGGG + Intergenic
1197501141 X:127243822-127243844 AACTGAGGCATGGAGTAGGGAGG + Intergenic
1199562049 X:149173304-149173326 CACTGATGCCTGTTGTGGGGTGG - Intergenic
1199588812 X:149446296-149446318 CACTGATGCCTGTTGGAGGGTGG - Intergenic
1201393371 Y:13522456-13522478 AAATGCTGGCTGTGGTATGGGGG - Intergenic
1202332879 Y:23773158-23773180 CACTGAAGCCTGTCGTGTGGTGG - Intergenic
1202537890 Y:25896905-25896927 CACTGAAGCCTGTCGTGTGGTGG + Intergenic