ID: 1128741746

View in Genome Browser
Species Human (GRCh38)
Location 15:70088762-70088784
Sequence CAGAATTACCAATATGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 270}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128741746 Original CRISPR CAGAATTACCAATATGAGAA AGG Intronic
905188895 1:36217627-36217649 AAGAATTACCAAAATGTGACAGG - Intergenic
906483520 1:46217155-46217177 AGGAATTACCAAGATGATAATGG + Intronic
907464614 1:54626791-54626813 CAGCAGTTCCAAAATGAGAATGG - Intronic
907593708 1:55700478-55700500 CAGAGTTACTCATGTGAGAATGG - Intergenic
908734425 1:67261181-67261203 CATAATTAACAATAGGACAATGG - Intergenic
909850160 1:80451493-80451515 CAGAAATACCATTCTGTGAATGG - Intergenic
910355385 1:86346788-86346810 AAAAATTAAAAATATGAGAAAGG + Intergenic
912083264 1:105966199-105966221 CAATATTACCAATATGAATAGGG + Intergenic
912255794 1:108056681-108056703 CAGAATTGCCATAATTAGAAAGG - Intergenic
914372722 1:147043872-147043894 CAGAACTACAAATGTCAGAAAGG + Intergenic
914576778 1:148978888-148978910 CAGAACTACAAATGTCAGAAAGG - Intronic
915485585 1:156218045-156218067 CAGAATGACAAATATTAGAATGG - Intronic
915919900 1:159968308-159968330 AAGAATTACAAAAATGAGATGGG - Intergenic
917793830 1:178517665-178517687 TAGAATTTACAATATGATAAAGG + Intronic
917879699 1:179322219-179322241 CAGAATGATCAATATGTTAAGGG - Intronic
918710540 1:187722566-187722588 GAGAATCACTAATATTAGAAAGG + Intergenic
918820653 1:189250181-189250203 AAGAACTACCAATAGCAGAAAGG + Intergenic
918980315 1:191549202-191549224 CAGAATTAATAACATGAGGATGG - Intergenic
919361445 1:196600854-196600876 CAGAAATCTCAAGATGAGAAGGG + Intronic
920123269 1:203674466-203674488 AAAAATTATCAAGATGAGAAAGG - Intronic
924497595 1:244605148-244605170 CAGAATTACTATGATGAGAACGG - Intronic
1063286314 10:4692375-4692397 CAGAAACACCAATGTGAGTAAGG + Intergenic
1063495037 10:6499164-6499186 CATATTTACCAATGTGAAAAAGG + Intronic
1064308537 10:14190256-14190278 TAGAACTACCAACATGAGAGGGG - Intronic
1064580278 10:16786715-16786737 GAGAATTACAAATACGGGAAGGG - Intronic
1065493296 10:26304358-26304380 CAGAAACACCAATTTGGGAACGG - Exonic
1065608428 10:27445578-27445600 CAAAATTACCAGCATAAGAATGG - Intergenic
1065809595 10:29429086-29429108 CAAAATTACCAACACGAGTATGG - Intergenic
1066469812 10:35687641-35687663 CAGAATTTCTAAAATGGGAAGGG - Intergenic
1069107906 10:64405987-64406009 CAGAGTTACAAATATGGAAAGGG + Intergenic
1069352305 10:67543555-67543577 GAGAATAACCAAAATGAAAAGGG + Intronic
1071539299 10:86465996-86466018 TGGAATCACCAATATGTGAATGG + Intronic
1071591007 10:86873241-86873263 CAGAAATACAAATATGAGTATGG - Intronic
1071908612 10:90204126-90204148 CAAAATTTCTAATATGAGAATGG + Intergenic
1073178194 10:101569228-101569250 CTGGCTTCCCAATATGAGAATGG + Intergenic
1073929476 10:108557587-108557609 ATAAATTACCAATATCAGAAAGG + Intergenic
1074661104 10:115658781-115658803 CTTTATTAGCAATATGAGAATGG - Intronic
1077382416 11:2250323-2250345 CAGCACCACCAAGATGAGAAAGG + Intergenic
1078335320 11:10458653-10458675 CAGAATTATGATTATGAGGATGG - Intronic
1078384571 11:10877533-10877555 AAGAGGTACCAACATGAGAAAGG - Intergenic
1079888976 11:26026476-26026498 CTGAATCAGCAATCTGAGAATGG - Intergenic
1081690555 11:45074975-45074997 CAGCATTGCCAATATGAGGAAGG - Intergenic
1081696683 11:45116059-45116081 AACAATTACAAATATCAGAAAGG + Intronic
1081745680 11:45470887-45470909 CAGAATTACCAAGACCAGCAGGG - Intergenic
1082008500 11:47434876-47434898 GAGAATTACAAATATGGAAAGGG - Intergenic
1086001717 11:81992146-81992168 GAGAATTACAAAAATGAAAAAGG + Intergenic
1087584238 11:100098008-100098030 CAGAATTACCAAGATGAGCTAGG + Intronic
1088532507 11:110826291-110826313 CAGAATGAGCAATATCACAAAGG - Intergenic
1089033321 11:115357108-115357130 CAAAATCTCCAATATGACAATGG + Intronic
1090071322 11:123546934-123546956 CAGAATGACCAGTAGGAGCAGGG + Intronic
1090500465 11:127255889-127255911 CAGAATTACAAATATAGTAAAGG - Intergenic
1090687173 11:129135212-129135234 CAGAAGTACCAAGATAAGAAGGG + Intronic
1093232083 12:16557933-16557955 CAGTATTATCAATATAAAAATGG - Intronic
1093475215 12:19547325-19547347 CAGACTTACAAATATGAAGAAGG - Intronic
1094539474 12:31351265-31351287 CTTTATTACCAACATGAGAATGG + Intergenic
1094539830 12:31353892-31353914 CAGAATCTCCACAATGAGAACGG - Intergenic
1095168920 12:39010050-39010072 CAGAAAGACCAAGATGAAAAGGG + Intergenic
1095297434 12:40542908-40542930 CAGAATGAGCATTATGAGATTGG + Intronic
1095895926 12:47280605-47280627 CAGCATTTCCAGTAAGAGAAGGG + Intergenic
1095937334 12:47699731-47699753 AAGTATTATCAATAAGAGAATGG + Intronic
1096088271 12:48881010-48881032 CAAAAATACAAATATGAGCAGGG + Intergenic
1098147899 12:67516449-67516471 AATAATTACCAATAAGAGAGAGG + Intergenic
1098457488 12:70691414-70691436 TAGAATTAGCAACATGAAAAGGG - Intronic
1098593877 12:72247790-72247812 CAGAATTACTGACATCAGAATGG + Intronic
1099210578 12:79783159-79783181 CAGAATTTCAAATATGAGGCTGG + Intronic
1099388180 12:82044789-82044811 AAGAATTGCCAATAAGAAAAAGG - Intergenic
1101112844 12:101503157-101503179 TAGAAGTTCCAAAATGAGAAGGG - Intergenic
1101867952 12:108536582-108536604 CAGAATTAGTAAAATTAGAAAGG + Intronic
1105482435 13:20791064-20791086 AAGAACAACCAATATGACAAAGG + Intronic
1105790583 13:23794376-23794398 CAGCGTTAGCAATATGAGGAAGG - Intronic
1107543673 13:41416884-41416906 CTGGATTACCAACAAGAGAAAGG - Intergenic
1110630831 13:77706240-77706262 CATAAAAACCATTATGAGAAGGG - Intronic
1110685752 13:78371999-78372021 CAGAATGACCATTATTAAAAAGG - Intergenic
1110744791 13:79039623-79039645 CAGAATTCCAAATGTGAGAGTGG + Intergenic
1112619406 13:101039290-101039312 GACAAATACCAATTTGAGAAAGG + Intergenic
1113234746 13:108259241-108259263 CAGAATTACAAAAATAATAAAGG - Intronic
1114158897 14:20140407-20140429 CAGAATTAGCAGGAAGAGAATGG + Intergenic
1114374778 14:22132551-22132573 CAGAATGACCACTAAGAGCATGG - Intergenic
1116107829 14:40533361-40533383 TACAATTACCAAAATGAAAACGG + Intergenic
1116245210 14:42402448-42402470 CAAAATGACCTATTTGAGAATGG + Intergenic
1116254235 14:42529874-42529896 CAGAATACCCAATAGGATAATGG - Intergenic
1117241034 14:53833336-53833358 CAAAATTACCAATAGCTGAAAGG + Intergenic
1120633556 14:86923064-86923086 ACAAATTACCAATATCAGAATGG - Intergenic
1124037841 15:26072726-26072748 GAGAGTTACAAATATGAGAAAGG - Intergenic
1126539631 15:49807630-49807652 AAGAAATACCCATATGAAAATGG + Intergenic
1128741746 15:70088762-70088784 CAGAATTACCAATATGAGAAAGG + Intronic
1130244860 15:82237477-82237499 CAGAATTGCTAAAATGAAAACGG + Intronic
1131209186 15:90478948-90478970 CAGCATTACCAATATTTGATTGG - Intronic
1131582732 15:93661022-93661044 CAGAGTTCCCTATATGAGCAGGG + Intergenic
1132131548 15:99285067-99285089 CAGAAATACCATAATGTGAATGG - Intronic
1133873224 16:9709073-9709095 CAGAAATTCCACTATGAGAAAGG - Intergenic
1137620236 16:49871553-49871575 CAGAAGTACCTGTATGGGAAGGG + Intergenic
1141378046 16:83549720-83549742 TTGAATTTCCAATAAGAGAAAGG + Intronic
1141874697 16:86815302-86815324 ACAAATTACCAATATCAGAAAGG - Intergenic
1141874939 16:86817623-86817645 ACAAATTACCAATATCAGAAAGG - Intergenic
1143069778 17:4281385-4281407 CAGAGTTAGGAATATGAGAAAGG + Intronic
1144184894 17:12788083-12788105 CAGAATTACTAATCTTATAAAGG - Intergenic
1144931288 17:18861133-18861155 CTTAATTACCAACAGGAGAAAGG + Intronic
1148997652 17:51725274-51725296 TTGAATAACCCATATGAGAAAGG + Intronic
1150541644 17:66106180-66106202 AAGAATTATCAATATGAAAAAGG + Intronic
1153437212 18:5080208-5080230 CAGAATGAACAATGTGAGCATGG + Intergenic
1153991623 18:10405755-10405777 CAGAACAACCTATCTGAGAATGG + Intergenic
1155638616 18:27985225-27985247 CAAAATCACCTATATGAAAAAGG + Exonic
1157740400 18:50087831-50087853 CAGGAAAACCAAGATGAGAAAGG + Intronic
1158019293 18:52822463-52822485 GAGAATTACAAATAAGAAAAAGG - Intronic
1158086788 18:53660953-53660975 GAGTCTTACTAATATGAGAAGGG - Intergenic
1158459808 18:57636191-57636213 ATGTATTAACAATATGAGAAAGG - Intergenic
1158669402 18:59461407-59461429 CATAATTAAAATTATGAGAAAGG - Intronic
1159439204 18:68455878-68455900 CATTATTAGCAATGTGAGAATGG + Intergenic
1159777306 18:72618757-72618779 CAGAAATACCATTCTGTGAATGG + Intronic
1164252380 19:23491317-23491339 AAGCATTACCAATATGAAGAGGG - Intergenic
1168188343 19:54716686-54716708 GAAAATTACCAATATCAGAAAGG + Intergenic
926238101 2:11064685-11064707 CAAACTGACCAATATGAAAAAGG - Intergenic
927235071 2:20865886-20865908 GAGAATAACAAATATGAGATGGG + Intergenic
928246520 2:29633703-29633725 GCAAATTACCAATATGAGGAAGG + Intronic
928460277 2:31465994-31466016 GAGAATTACCAGTGTGAGCAAGG + Intergenic
928776810 2:34775200-34775222 CACAATCATCAATATGAGATTGG - Intergenic
928844864 2:35658657-35658679 CAAAATCATAAATATGAGAAAGG + Intergenic
929425720 2:41842805-41842827 TAGAATTAACAACAAGAGAATGG - Intergenic
929793973 2:45044332-45044354 AAGAATTACCAGAAGGAGAATGG - Intergenic
930972706 2:57416626-57416648 CAGAATTCCAAGTCTGAGAAAGG + Intergenic
932133377 2:69207397-69207419 CAGAAATACCAACATTAGAATGG + Intronic
932985025 2:76715733-76715755 CAGAATAAGAAACATGAGAACGG + Intergenic
934012244 2:87835278-87835300 CAGAAATATCAACAAGAGAAAGG + Intergenic
935094205 2:99928237-99928259 CAGATGTACTAATATGGGAAGGG + Intronic
935603750 2:104948777-104948799 GATAATTACCAAAATGAGTAGGG - Intergenic
937166264 2:119820986-119821008 CTGAATTACCAAGAGGATAAAGG - Intronic
939255423 2:139738118-139738140 CAGAATTAGCAATGTCAGCAGGG + Intergenic
939877665 2:147596092-147596114 CAAAATTTCAAATCTGAGAAGGG + Intergenic
940604906 2:155909365-155909387 CACAGTTGCTAATATGAGAAAGG + Intergenic
941501451 2:166283466-166283488 CTGCATTACCAATATCAGCAAGG - Intronic
942222851 2:173788297-173788319 GACATTTACCAATATCAGAAGGG + Intergenic
942989998 2:182188970-182188992 CAGAATTACCTATTTGTGACTGG + Exonic
942990942 2:182201793-182201815 CAGAGTCACCAAAAGGAGAAAGG + Intronic
943554237 2:189382476-189382498 TAGAATTAACTATATGACAAAGG - Intergenic
943775276 2:191758929-191758951 TAGAGTTAGTAATATGAGAATGG + Intergenic
944086145 2:195850168-195850190 GAGAATAACCAAAATGAGCATGG + Intronic
944506039 2:200412212-200412234 TAGAATTACAACTATTAGAAAGG - Intronic
945560640 2:211335593-211335615 CAGATTATCAAATATGAGAAGGG - Intergenic
946081714 2:217125791-217125813 AAGGAATACCAAGATGAGAATGG - Intergenic
947788060 2:232842517-232842539 CAGAAATAGAAATAAGAGAACGG - Intronic
947824524 2:233095799-233095821 TAGGGTTACCAATAGGAGAAGGG - Intronic
1169126422 20:3130824-3130846 AAGAGTTACCATTTTGAGAAAGG - Intronic
1170283703 20:14681098-14681120 TAGAATTACCAACATTAAAAAGG + Intronic
1173687778 20:44936274-44936296 TAAAATTACCAAGATGTGAAAGG + Intronic
1177023513 21:15893257-15893279 CAAAATTATTAATATGTGAAGGG + Intergenic
1177226589 21:18264746-18264768 CAGAATTCCAAATGTGACAAGGG + Intronic
1177410471 21:20723775-20723797 CAGAATTACAAAAATAAAAACGG - Intergenic
1177540527 21:22487766-22487788 GAAAATTAGCAATAAGAGAATGG - Intergenic
1180029273 21:45192722-45192744 CAAAATTACCAATATCGGAATGG + Intronic
1182777978 22:32845151-32845173 CAGAAGCACCAATCAGAGAAGGG - Intronic
1183143418 22:35966508-35966530 CAGAATGACTAAAATGAAAAAGG - Intronic
951184741 3:19700270-19700292 CAGAAGTATAAATATGAAAAAGG - Intergenic
951275917 3:20685911-20685933 CAAAGTTAACATTATGAGAATGG - Intergenic
952134436 3:30400758-30400780 AGGAAATACCAATATGGGAAAGG - Intergenic
952154271 3:30626264-30626286 CAGCATAACAAATATGAGCAAGG + Intronic
952298326 3:32081356-32081378 CTTTATTACCAACATGAGAATGG - Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955602733 3:60664835-60664857 CAAAATTACCAATACCAGGAAGG - Intronic
955814350 3:62826222-62826244 CAGACTTATCAAAAAGAGAAAGG + Intronic
956927908 3:74009298-74009320 CAGAATTGCAAATTTGTGAATGG - Intergenic
957959845 3:87235250-87235272 CAGAAGGAATAATATGAGAACGG - Intronic
959362444 3:105410251-105410273 CAGAATTAGCACAATGGGAAAGG + Intronic
960614980 3:119588267-119588289 AGGAAATACCGATATGAGAATGG + Exonic
961007210 3:123413116-123413138 CAGAGTTTCCAAGATGAAAATGG - Intronic
961773381 3:129266643-129266665 CAGAATAATAAAAATGAGAAAGG - Intronic
961951921 3:130758678-130758700 GTGAATGACCAATATGAAAAAGG - Intergenic
963276722 3:143338755-143338777 CAGAGTTATGAATGTGAGAATGG + Intronic
963668725 3:148224229-148224251 CAGAAGTGCCAATAAGAGAGGGG - Intergenic
965895600 3:173571813-173571835 CAGTATTATTAATAGGAGAAAGG - Intronic
968297191 3:197585751-197585773 CAGAATTACCAATAGACTAATGG - Intergenic
969828793 4:9779347-9779369 CACAATTACAAATGTGACAAGGG - Intronic
970833769 4:20375150-20375172 CATAATAACCAAGATGATAATGG - Intronic
971050135 4:22852542-22852564 CAGTATTACCATTATCAGTAGGG - Intergenic
971604807 4:28644480-28644502 TAGAATTTAGAATATGAGAATGG - Intergenic
972812258 4:42603017-42603039 GATAATTACTAATATGAGATAGG - Intronic
973255397 4:48107263-48107285 CCGAATTATCAATATTACAATGG - Intronic
973566765 4:52196710-52196732 TAGAATTACCTAAAAGAGAAAGG + Intergenic
975868077 4:78746326-78746348 CACAATGATCAAGATGAGAATGG - Intergenic
976821803 4:89215184-89215206 TGGAATTACCAATATGTAAAAGG - Intergenic
979067758 4:116159328-116159350 CAGATTTACCAAGTTGAGATGGG + Intergenic
979894655 4:126145039-126145061 CAGCATTAACAATGTAAGAAGGG - Intergenic
981531574 4:145759212-145759234 CAGAATTTCCAGTATGAAACAGG - Intronic
981667397 4:147245431-147245453 CAGAATTACTAGTATGGGAAAGG - Intergenic
982316628 4:154038168-154038190 TAGAATCGCTAATATGAGAAGGG + Intergenic
982527751 4:156501269-156501291 CAGATTTTCAAACATGAGAAAGG + Intergenic
983399316 4:167243729-167243751 CAGAATATCCAAATTGAGAAAGG - Intergenic
983886292 4:172984172-172984194 CTGTATTAGCAATCTGAGAACGG - Intronic
984114008 4:175656100-175656122 AATAATGACCAAAATGAGAAAGG - Intronic
985177395 4:187215871-187215893 GAGAATCACCAATATGGAAAAGG + Intergenic
986570934 5:9165393-9165415 CAGAATTAATAAAAAGAGAATGG - Intronic
987688784 5:21240628-21240650 TAAAATTTCTAATATGAGAAAGG + Intergenic
987734491 5:21823305-21823327 CAGAAGTAACCATATGACAAAGG + Intronic
987903327 5:24042542-24042564 CAGAATATCCAATAAGAGACTGG - Intronic
988447259 5:31301481-31301503 TAGAATTACAAATATAAGTATGG + Intronic
989782875 5:45290279-45290301 CTTAATTAGCAATGTGAGAATGG + Intronic
990561843 5:56991344-56991366 CCGCATTGCCAAGATGAGAAAGG + Intergenic
991959664 5:72031654-72031676 CAGGGTTAGCAATATGAGCAAGG - Intergenic
992846875 5:80759251-80759273 TATGATTACCATTATGAGAAGGG + Intronic
993128424 5:83864312-83864334 AAGAATTACCATTCTGAGATTGG + Intergenic
995493439 5:112716978-112717000 CAAAAATAACTATATGAGAAGGG - Intronic
997124049 5:131208192-131208214 TAGAATGGCCAATATTAGAATGG + Intergenic
997230830 5:132241613-132241635 CAGAAATCCCAATAGGAAAATGG - Intronic
997771523 5:136558907-136558929 CAAAAATACCAAAATTAGAAGGG + Intergenic
998687488 5:144545931-144545953 GAGAAGTAGGAATATGAGAATGG - Intergenic
998906492 5:146910994-146911016 CAGAGTTAACTATATGAAAAGGG - Intronic
999360064 5:150976695-150976717 CAGAATTAAGAAAGTGAGAAGGG + Intergenic
999691121 5:154146690-154146712 GAGAATTGCCAGTATTAGAAGGG + Intronic
1000062990 5:157672460-157672482 CAAATTTACCAATACTAGAAGGG - Intronic
1004264128 6:14134210-14134232 CAGAAATACCAAAAATAGAAGGG - Intronic
1005047808 6:21658733-21658755 AAGAATTAGAAATAGGAGAAAGG + Intergenic
1006973383 6:38070823-38070845 CAGCATTACCAATATTAGGTGGG + Intronic
1009411989 6:63376662-63376684 TAGAATTTTAAATATGAGAAAGG + Intergenic
1009719679 6:67451496-67451518 CAGAAATACAAAAATCAGAAAGG - Intergenic
1009827668 6:68887966-68887988 AAGGAGCACCAATATGAGAAGGG - Intronic
1010612232 6:77967542-77967564 GAGAATTACAAAAATAAGAATGG + Intergenic
1010981531 6:82375376-82375398 CTTTATTAGCAATATGAGAATGG - Intergenic
1011647598 6:89474715-89474737 CAGATTTAAAAAGATGAGAAAGG - Intronic
1011848482 6:91595881-91595903 AAGAATTACAAATATTTGAAAGG + Intergenic
1012467108 6:99528121-99528143 CAAAATGACCACTATAAGAAAGG - Intergenic
1012802706 6:103852507-103852529 CAGAAAGAACATTATGAGAAAGG + Intergenic
1014189798 6:118482123-118482145 CAGAATTACAAGGAAGAGAATGG + Intronic
1015057930 6:128926679-128926701 GAGGATTACCAATATTAAAAAGG - Intronic
1015846913 6:137530527-137530549 CAGAATTAGCAAGAGGAGAGTGG - Intergenic
1016338817 6:143038792-143038814 CAAATTTACAAATATGAAAAGGG - Intergenic
1017046710 6:150353293-150353315 CAGTATTACAAATGTCAGAAGGG - Intergenic
1017691332 6:156968595-156968617 TAGAAATACCCATATGTGAATGG + Intronic
1017852791 6:158319779-158319801 CAGAATACACAATGTGAGAAAGG - Intronic
1018332278 6:162742466-162742488 CTTTATTACCAATAGGAGAATGG + Intronic
1021029001 7:15705983-15706005 CAGAATTAGAAATATCAAAAAGG + Intergenic
1021073379 7:16271598-16271620 CAGAAGTAACAGTATGTGAAAGG - Intronic
1021351648 7:19601796-19601818 AATAATTACCAAAATTAGAAGGG - Intergenic
1022538302 7:31111940-31111962 CATTATGACCAATATGAAAATGG - Intergenic
1022827174 7:34026621-34026643 CAGAGTTACTAAAATGAAAATGG + Intronic
1023233253 7:38055973-38055995 CTAAATTACCAATATTAGAAAGG + Intergenic
1023351561 7:39325155-39325177 CAGAATTACAAATCTGGCAAAGG + Intronic
1024118175 7:46212349-46212371 CAGAAATCCCAACATGTGAAGGG + Intergenic
1024829849 7:53437913-53437935 GTGGATCACCAATATGAGAAAGG + Intergenic
1027446193 7:78275498-78275520 CAGAATTAGCTATATTTGAATGG + Intronic
1027894244 7:84020614-84020636 GAGATTTACCAAAATGAAAAAGG - Intronic
1027913259 7:84280408-84280430 CATAATTCACAATATGAGCATGG - Intronic
1030284192 7:107808834-107808856 CAGAAATACCAATATTGGACTGG + Intergenic
1031342700 7:120623801-120623823 AAGAATTACAAAAATGTGAATGG + Intronic
1031541799 7:123004251-123004273 CAAAATTAGAAATAGGAGAAAGG - Intergenic
1031833879 7:126658746-126658768 CAGAAATCCCAATATTAGATTGG + Intronic
1032287499 7:130552191-130552213 CATAATTACTAAAAAGAGAAAGG + Intronic
1032640063 7:133756504-133756526 AAGAATTACCAACATTAGAGAGG - Intronic
1033681480 7:143600149-143600171 CAGAATCACCACCATGAGATAGG + Intergenic
1033703412 7:143861664-143861686 CAGAATCACCACCATGAGATAGG - Intronic
1040490232 8:47913792-47913814 CAAAATTACTAATATTGGAATGG + Intronic
1041067324 8:54094457-54094479 CGGAATTACAAATATGGAAAGGG + Intronic
1042974755 8:74455447-74455469 CAGAATTGTTAATATGTGAAAGG + Intronic
1044910143 8:97048926-97048948 CTGAATCACCAAGATAAGAATGG + Intronic
1045194174 8:99913270-99913292 CAGAATGATGAATCTGAGAATGG + Intergenic
1046638176 8:116695881-116695903 GGGAATTACAAATATGAAAAGGG + Intronic
1046679342 8:117151158-117151180 AAGAATTAGCAAAAAGAGAAGGG - Intronic
1048155851 8:131950234-131950256 CTGAAGTAGCAAAATGAGAATGG + Intronic
1050658534 9:7856720-7856742 CAGTCTTACCAATTTGGGAAGGG - Intronic
1051021625 9:12551454-12551476 AAGAATTAAGACTATGAGAAAGG + Intergenic
1052298906 9:26931407-26931429 AAAAATTACCATTATGTGAAAGG + Intronic
1052882433 9:33611537-33611559 CAGAATTGCTAAAATGAAAAAGG - Intergenic
1053205294 9:36181197-36181219 CAGAACTACCCATCTGACAAGGG + Intergenic
1053493929 9:38534695-38534717 CAGAATTGCTAAAATGAAAAAGG - Intergenic
1055778581 9:79794198-79794220 AAGAATTACCCAAATGACAATGG + Intergenic
1057986533 9:99721229-99721251 CAAAAAAACCCATATGAGAAGGG + Intergenic
1058242291 9:102579838-102579860 AGGAATTACAAATATGAAAAGGG + Intergenic
1059183725 9:112245438-112245460 AAGAGTTACCAATATGTAAAGGG + Intronic
1059530234 9:115028797-115028819 CAGAATGACAAAAAAGAGAATGG - Intronic
1185965997 X:4603642-4603664 AACAATTAGCAATATCAGAAGGG - Intergenic
1188599928 X:31949870-31949892 AAGAATTACCAAAATCATAAAGG - Intronic
1189667368 X:43371033-43371055 CCAAATTACTAATATCAGAAAGG + Intergenic
1189960199 X:46317019-46317041 CAGAAGGACCAATAAAAGAAAGG + Intergenic
1189966995 X:46385203-46385225 CAAAATAACCAATATGCCAAAGG + Intergenic
1191009668 X:55747557-55747579 CAAAATAACAAATATGAGATTGG - Intronic
1192121162 X:68457380-68457402 TATAGTTACCTATATGAGAAGGG + Intergenic
1192397931 X:70802706-70802728 CAGAATTAAGAATATGACTAAGG + Intronic
1192977015 X:76297527-76297549 CAGAACTACCTATCTAAGAACGG - Intergenic
1193105783 X:77670257-77670279 CAGAATTATAAATAAGATAATGG + Intronic
1193396951 X:80996164-80996186 TAGGAATACCAATTTGAGAAAGG + Intergenic
1195433250 X:104812966-104812988 AAGAATTAGCAAAATGAGCAAGG + Intronic
1196366589 X:114931134-114931156 CAGAATTACTAGTAAAAGAAGGG + Intergenic
1197286376 X:124599865-124599887 GAGAGTTACAAATATGAAAAAGG + Intronic
1197494898 X:127166767-127166789 CAGCATTTCTACTATGAGAAAGG + Intergenic
1197853828 X:130893512-130893534 CAGAAGTACAAAGATTAGAAAGG + Intronic
1199008943 X:142736698-142736720 AAGAATTACAAATATGAGCCAGG + Intergenic
1199132239 X:144203263-144203285 CAGAAATATCAACAAGAGAAAGG - Intergenic
1201523292 Y:14901876-14901898 AAGAATTACCCATATGAATAAGG + Intergenic