ID: 1128743674

View in Genome Browser
Species Human (GRCh38)
Location 15:70099258-70099280
Sequence AACCTCCGGCTCCTAATGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128743674_1128743681 22 Left 1128743674 15:70099258-70099280 CCCCTCATTAGGAGCCGGAGGTT No data
Right 1128743681 15:70099303-70099325 GCTGAGAGCTAGCGGGCGCTCGG No data
1128743674_1128743679 14 Left 1128743674 15:70099258-70099280 CCCCTCATTAGGAGCCGGAGGTT No data
Right 1128743679 15:70099295-70099317 AATGAGGAGCTGAGAGCTAGCGG No data
1128743674_1128743683 29 Left 1128743674 15:70099258-70099280 CCCCTCATTAGGAGCCGGAGGTT No data
Right 1128743683 15:70099310-70099332 GCTAGCGGGCGCTCGGAGGCCGG No data
1128743674_1128743680 15 Left 1128743674 15:70099258-70099280 CCCCTCATTAGGAGCCGGAGGTT No data
Right 1128743680 15:70099296-70099318 ATGAGGAGCTGAGAGCTAGCGGG No data
1128743674_1128743682 25 Left 1128743674 15:70099258-70099280 CCCCTCATTAGGAGCCGGAGGTT No data
Right 1128743682 15:70099306-70099328 GAGAGCTAGCGGGCGCTCGGAGG No data
1128743674_1128743678 -2 Left 1128743674 15:70099258-70099280 CCCCTCATTAGGAGCCGGAGGTT No data
Right 1128743678 15:70099279-70099301 TTCGCTTTTGCATCTTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128743674 Original CRISPR AACCTCCGGCTCCTAATGAG GGG (reversed) Intergenic
No off target data available for this crispr