ID: 1128743678

View in Genome Browser
Species Human (GRCh38)
Location 15:70099279-70099301
Sequence TTCGCTTTTGCATCTTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128743675_1128743678 -3 Left 1128743675 15:70099259-70099281 CCCTCATTAGGAGCCGGAGGTTC No data
Right 1128743678 15:70099279-70099301 TTCGCTTTTGCATCTTAATGAGG No data
1128743668_1128743678 15 Left 1128743668 15:70099241-70099263 CCCCGGATCTATATTTTCCCCTC No data
Right 1128743678 15:70099279-70099301 TTCGCTTTTGCATCTTAATGAGG No data
1128743669_1128743678 14 Left 1128743669 15:70099242-70099264 CCCGGATCTATATTTTCCCCTCA No data
Right 1128743678 15:70099279-70099301 TTCGCTTTTGCATCTTAATGAGG No data
1128743676_1128743678 -4 Left 1128743676 15:70099260-70099282 CCTCATTAGGAGCCGGAGGTTCG No data
Right 1128743678 15:70099279-70099301 TTCGCTTTTGCATCTTAATGAGG No data
1128743674_1128743678 -2 Left 1128743674 15:70099258-70099280 CCCCTCATTAGGAGCCGGAGGTT No data
Right 1128743678 15:70099279-70099301 TTCGCTTTTGCATCTTAATGAGG No data
1128743667_1128743678 23 Left 1128743667 15:70099233-70099255 CCGCGCGTCCCCGGATCTATATT No data
Right 1128743678 15:70099279-70099301 TTCGCTTTTGCATCTTAATGAGG No data
1128743670_1128743678 13 Left 1128743670 15:70099243-70099265 CCGGATCTATATTTTCCCCTCAT No data
Right 1128743678 15:70099279-70099301 TTCGCTTTTGCATCTTAATGAGG No data
1128743666_1128743678 27 Left 1128743666 15:70099229-70099251 CCGGCCGCGCGTCCCCGGATCTA No data
Right 1128743678 15:70099279-70099301 TTCGCTTTTGCATCTTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128743678 Original CRISPR TTCGCTTTTGCATCTTAATG AGG Intergenic
No off target data available for this crispr