ID: 1128743680

View in Genome Browser
Species Human (GRCh38)
Location 15:70099296-70099318
Sequence ATGAGGAGCTGAGAGCTAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128743677_1128743680 1 Left 1128743677 15:70099272-70099294 CCGGAGGTTCGCTTTTGCATCTT No data
Right 1128743680 15:70099296-70099318 ATGAGGAGCTGAGAGCTAGCGGG No data
1128743670_1128743680 30 Left 1128743670 15:70099243-70099265 CCGGATCTATATTTTCCCCTCAT No data
Right 1128743680 15:70099296-70099318 ATGAGGAGCTGAGAGCTAGCGGG No data
1128743674_1128743680 15 Left 1128743674 15:70099258-70099280 CCCCTCATTAGGAGCCGGAGGTT No data
Right 1128743680 15:70099296-70099318 ATGAGGAGCTGAGAGCTAGCGGG No data
1128743676_1128743680 13 Left 1128743676 15:70099260-70099282 CCTCATTAGGAGCCGGAGGTTCG No data
Right 1128743680 15:70099296-70099318 ATGAGGAGCTGAGAGCTAGCGGG No data
1128743675_1128743680 14 Left 1128743675 15:70099259-70099281 CCCTCATTAGGAGCCGGAGGTTC No data
Right 1128743680 15:70099296-70099318 ATGAGGAGCTGAGAGCTAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128743680 Original CRISPR ATGAGGAGCTGAGAGCTAGC GGG Intergenic
No off target data available for this crispr