ID: 1128744442

View in Genome Browser
Species Human (GRCh38)
Location 15:70103634-70103656
Sequence CTGAAATGGGAGTCGGGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128744442_1128744455 24 Left 1128744442 15:70103634-70103656 CCCTATCCCGACTCCCATTTCAG No data
Right 1128744455 15:70103681-70103703 GTTACTACAGCCAGGAGAGAGGG No data
1128744442_1128744454 23 Left 1128744442 15:70103634-70103656 CCCTATCCCGACTCCCATTTCAG No data
Right 1128744454 15:70103680-70103702 GGTTACTACAGCCAGGAGAGAGG No data
1128744442_1128744450 2 Left 1128744442 15:70103634-70103656 CCCTATCCCGACTCCCATTTCAG No data
Right 1128744450 15:70103659-70103681 TCCAGTGAGGATGCCTCTGAAGG No data
1128744442_1128744453 16 Left 1128744442 15:70103634-70103656 CCCTATCCCGACTCCCATTTCAG No data
Right 1128744453 15:70103673-70103695 CTCTGAAGGTTACTACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128744442 Original CRISPR CTGAAATGGGAGTCGGGATA GGG (reversed) Intergenic
No off target data available for this crispr