ID: 1128744561

View in Genome Browser
Species Human (GRCh38)
Location 15:70104264-70104286
Sequence CATGCCCACCTGAGACTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128744557_1128744561 4 Left 1128744557 15:70104237-70104259 CCAGGCGATGATTTACAATGAGG No data
Right 1128744561 15:70104264-70104286 CATGCCCACCTGAGACTTTGTGG No data
1128744556_1128744561 12 Left 1128744556 15:70104229-70104251 CCAGACTACCAGGCGATGATTTA No data
Right 1128744561 15:70104264-70104286 CATGCCCACCTGAGACTTTGTGG No data
1128744554_1128744561 29 Left 1128744554 15:70104212-70104234 CCAGAAAGCTTTGGAAGCCAGAC No data
Right 1128744561 15:70104264-70104286 CATGCCCACCTGAGACTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128744561 Original CRISPR CATGCCCACCTGAGACTTTG TGG Intergenic
No off target data available for this crispr