ID: 1128747390

View in Genome Browser
Species Human (GRCh38)
Location 15:70124085-70124107
Sequence CCCCAGCTGGACCACTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128747383_1128747390 22 Left 1128747383 15:70124040-70124062 CCATCGATGAGTTGCCAGGTGAG No data
Right 1128747390 15:70124085-70124107 CCCCAGCTGGACCACTGTGAGGG No data
1128747384_1128747390 8 Left 1128747384 15:70124054-70124076 CCAGGTGAGAATATGTCCATCTG No data
Right 1128747390 15:70124085-70124107 CCCCAGCTGGACCACTGTGAGGG No data
1128747385_1128747390 -8 Left 1128747385 15:70124070-70124092 CCATCTGCTCAGCCTCCCCAGCT No data
Right 1128747390 15:70124085-70124107 CCCCAGCTGGACCACTGTGAGGG No data
1128747381_1128747390 24 Left 1128747381 15:70124038-70124060 CCCCATCGATGAGTTGCCAGGTG No data
Right 1128747390 15:70124085-70124107 CCCCAGCTGGACCACTGTGAGGG No data
1128747382_1128747390 23 Left 1128747382 15:70124039-70124061 CCCATCGATGAGTTGCCAGGTGA No data
Right 1128747390 15:70124085-70124107 CCCCAGCTGGACCACTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128747390 Original CRISPR CCCCAGCTGGACCACTGTGA GGG Intergenic
No off target data available for this crispr